Mutagenetix > Incidental Mutation

Incidental Mutation 'R1085:Nup155'

84992

Institutional Source

Beutler Lab

Gene Symbol

Nup155

Ensembl Gene

ENSMUSG00000022142

Gene Name

nucleoporin 155

Synonyms

D930027M19Rik

MMRRC Submission

039171-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1085 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

8138757-8190731 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 8187244 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 1391 (H1391L)

Ref Sequence

ENSEMBL: ENSMUSP00000128819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]

AlphaFold

Q99P88

Predicted Effect

probably damaging
Transcript: ENSMUST00000163765
AA Change: H1391L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: H1391L

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
Pfam:Nucleoporin_N	77	510	3.5e-105	PFAM
low complexity region	600	619	N/A	INTRINSIC
Pfam:Nucleoporin_C	678	1221	3.6e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000230017

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230925

Meta Mutation Damage Score

0.0878

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agxt2	A	T	15: 10,388,338 (GRCm39)	T278S	probably benign	Het
Ahnak	T	A	19: 8,990,489 (GRCm39)	D3924E	possibly damaging	Het
Cfap57	T	A	4: 118,452,976 (GRCm39)	T576S	probably benign	Het
Cntnap1	G	A	11: 101,069,662 (GRCm39)	R247K	probably benign	Het
Dipk1c	A	G	18: 84,757,509 (GRCm39)	I198V	possibly damaging	Het
Gldc	C	A	19: 30,128,828 (GRCm39)	C215F	probably damaging	Het
Grm4	T	A	17: 27,692,007 (GRCm39)	Y204F	probably damaging	Het
Itga11	T	G	9: 62,585,252 (GRCm39)	V9G	probably benign	Het
Mc2r	A	G	18: 68,540,417 (GRCm39)	F292S	probably benign	Het
Mcur1	A	G	13: 43,708,480 (GRCm39)	S124P	unknown	Het
Mrtfa	T	C	15: 80,905,084 (GRCm39)	D116G	probably damaging	Het
Nin	G	T	12: 70,067,736 (GRCm39)	Q1964K	possibly damaging	Het
Or5ae2	A	G	7: 84,505,987 (GRCm39)	T137A	probably benign	Het
Or5b117	C	T	19: 13,431,594 (GRCm39)	A96T	possibly damaging	Het
Psd2	G	A	18: 36,145,830 (GRCm39)	A745T	probably benign	Het
Rrp36	A	G	17: 46,978,878 (GRCm39)	*227Q	probably null	Het
Sh3tc2	A	C	18: 62,148,067 (GRCm39)	D1259A	probably benign	Het
Tedc2	T	A	17: 24,435,291 (GRCm39)	E366V	probably damaging	Het
Tedc2	C	A	17: 24,435,292 (GRCm39)	E366*	probably null	Het
Tex2	G	A	11: 106,459,313 (GRCm39)	S39L	probably damaging	Het
Tor1a	A	G	2: 30,857,796 (GRCm39)	I24T	possibly damaging	Het
Troap	T	C	15: 98,980,044 (GRCm39)	V408A	probably damaging	Het
Ttc16	A	T	2: 32,665,092 (GRCm39)	S12T	possibly damaging	Het
Wdr37	A	T	13: 8,855,964 (GRCm39)	C460S	probably damaging	Het

Other mutations in Nup155

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Nup155	APN	15	8,150,939 (GRCm39)	splice site	probably benign
IGL00426:Nup155	APN	15	8,186,278 (GRCm39)	makesense	probably null
IGL00765:Nup155	APN	15	8,182,712 (GRCm39)	missense	probably benign	0.16
IGL00936:Nup155	APN	15	8,157,889 (GRCm39)	splice site	probably benign
IGL01124:Nup155	APN	15	8,183,163 (GRCm39)	missense	probably damaging	0.97
IGL01739:Nup155	APN	15	8,165,272 (GRCm39)	missense	probably benign	0.01
IGL02013:Nup155	APN	15	8,143,132 (GRCm39)	missense	possibly damaging	0.61
IGL02066:Nup155	APN	15	8,187,250 (GRCm39)	unclassified	probably benign
IGL02231:Nup155	APN	15	8,173,548 (GRCm39)	missense	probably damaging	1.00
IGL02246:Nup155	APN	15	8,172,486 (GRCm39)	missense	probably benign
IGL02289:Nup155	APN	15	8,160,977 (GRCm39)	missense	probably damaging	1.00
IGL02608:Nup155	APN	15	8,138,955 (GRCm39)	missense	probably benign
IGL02749:Nup155	APN	15	8,163,560 (GRCm39)	missense	probably damaging	1.00
IGL02813:Nup155	APN	15	8,159,605 (GRCm39)	splice site	probably benign
IGL03102:Nup155	APN	15	8,176,768 (GRCm39)	missense	probably benign	0.00
H8930:Nup155	UTSW	15	8,187,142 (GRCm39)	missense	possibly damaging	0.50
IGL02835:Nup155	UTSW	15	8,172,614 (GRCm39)	missense	probably damaging	1.00
R0314:Nup155	UTSW	15	8,176,736 (GRCm39)	missense	probably benign	0.00
R0365:Nup155	UTSW	15	8,161,027 (GRCm39)	missense	probably damaging	1.00
R0586:Nup155	UTSW	15	8,159,716 (GRCm39)	missense	probably benign	0.39
R0764:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R0839:Nup155	UTSW	15	8,175,071 (GRCm39)	missense	possibly damaging	0.48
R0844:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1066:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1067:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1137:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1162:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1166:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1202:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1203:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1219:Nup155	UTSW	15	8,146,822 (GRCm39)	missense	possibly damaging	0.80
R1385:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1421:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1448:Nup155	UTSW	15	8,141,890 (GRCm39)	missense	probably benign	0.44
R1611:Nup155	UTSW	15	8,159,644 (GRCm39)	missense	probably damaging	1.00
R1836:Nup155	UTSW	15	8,184,464 (GRCm39)	missense	possibly damaging	0.79
R1863:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1866:Nup155	UTSW	15	8,145,010 (GRCm39)	missense	probably damaging	1.00
R1894:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R1976:Nup155	UTSW	15	8,165,311 (GRCm39)	missense	probably benign	0.01
R2024:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R2026:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R2027:Nup155	UTSW	15	8,187,244 (GRCm39)	missense	probably damaging	1.00
R2077:Nup155	UTSW	15	8,172,510 (GRCm39)	missense	probably damaging	1.00
R2111:Nup155	UTSW	15	8,150,951 (GRCm39)	missense	probably benign	0.45
R2921:Nup155	UTSW	15	8,183,125 (GRCm39)	missense	probably damaging	1.00
R2936:Nup155	UTSW	15	8,172,533 (GRCm39)	missense	possibly damaging	0.89
R3108:Nup155	UTSW	15	8,146,790 (GRCm39)	missense	probably null	1.00
R3161:Nup155	UTSW	15	8,177,867 (GRCm39)	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8,177,867 (GRCm39)	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8,177,867 (GRCm39)	missense	possibly damaging	0.56
R3522:Nup155	UTSW	15	8,186,162 (GRCm39)	splice site	probably benign
R4423:Nup155	UTSW	15	8,150,948 (GRCm39)	missense	probably damaging	0.99
R4451:Nup155	UTSW	15	8,180,366 (GRCm39)	missense	probably benign	0.02
R4498:Nup155	UTSW	15	8,183,157 (GRCm39)	missense	possibly damaging	0.88
R4780:Nup155	UTSW	15	8,187,187 (GRCm39)	missense	probably benign	0.00
R4822:Nup155	UTSW	15	8,158,010 (GRCm39)	missense	possibly damaging	0.49
R5013:Nup155	UTSW	15	8,153,722 (GRCm39)	missense	probably benign	0.00
R5064:Nup155	UTSW	15	8,165,354 (GRCm39)	missense	probably damaging	1.00
R5172:Nup155	UTSW	15	8,139,026 (GRCm39)	missense	probably benign	0.06
R5406:Nup155	UTSW	15	8,183,122 (GRCm39)	critical splice acceptor site	probably null
R5551:Nup155	UTSW	15	8,177,817 (GRCm39)	missense	probably benign	0.09
R5588:Nup155	UTSW	15	8,148,737 (GRCm39)	critical splice donor site	probably null
R5977:Nup155	UTSW	15	8,159,721 (GRCm39)	critical splice donor site	probably null
R6035:Nup155	UTSW	15	8,173,577 (GRCm39)	missense	probably benign
R6035:Nup155	UTSW	15	8,173,577 (GRCm39)	missense	probably benign
R6036:Nup155	UTSW	15	8,157,895 (GRCm39)	missense	probably benign	0.16
R6036:Nup155	UTSW	15	8,157,895 (GRCm39)	missense	probably benign	0.16
R6085:Nup155	UTSW	15	8,177,842 (GRCm39)	missense	probably damaging	0.98
R6188:Nup155	UTSW	15	8,139,059 (GRCm39)	missense	probably damaging	1.00
R6232:Nup155	UTSW	15	8,138,963 (GRCm39)	missense	probably benign	0.02
R6257:Nup155	UTSW	15	8,180,282 (GRCm39)	nonsense	probably null
R6262:Nup155	UTSW	15	8,186,225 (GRCm39)	missense	probably benign	0.03
R6267:Nup155	UTSW	15	8,182,639 (GRCm39)	missense	probably damaging	1.00
R6296:Nup155	UTSW	15	8,182,639 (GRCm39)	missense	probably damaging	1.00
R6299:Nup155	UTSW	15	8,157,922 (GRCm39)	missense	possibly damaging	0.88
R6303:Nup155	UTSW	15	8,147,526 (GRCm39)	missense	probably damaging	1.00
R6304:Nup155	UTSW	15	8,147,526 (GRCm39)	missense	probably damaging	1.00
R6763:Nup155	UTSW	15	8,165,379 (GRCm39)	nonsense	probably null
R6958:Nup155	UTSW	15	8,176,638 (GRCm39)	missense	probably damaging	1.00
R7088:Nup155	UTSW	15	8,186,177 (GRCm39)	missense	probably benign	0.11
R7313:Nup155	UTSW	15	8,184,406 (GRCm39)	missense	probably damaging	0.96
R7451:Nup155	UTSW	15	8,175,091 (GRCm39)	nonsense	probably null
R7560:Nup155	UTSW	15	8,184,531 (GRCm39)	missense	probably benign	0.39
R7633:Nup155	UTSW	15	8,138,937 (GRCm39)	missense	probably damaging	0.99
R7670:Nup155	UTSW	15	8,183,180 (GRCm39)	missense	probably damaging	0.99
R7726:Nup155	UTSW	15	8,151,623 (GRCm39)	missense	probably damaging	1.00
R7752:Nup155	UTSW	15	8,145,926 (GRCm39)	missense	possibly damaging	0.53
R7889:Nup155	UTSW	15	8,150,991 (GRCm39)	missense	probably damaging	0.98
R7899:Nup155	UTSW	15	8,148,663 (GRCm39)	missense	probably damaging	1.00
R7901:Nup155	UTSW	15	8,145,926 (GRCm39)	missense	possibly damaging	0.53
R8429:Nup155	UTSW	15	8,141,904 (GRCm39)	missense	probably damaging	0.96
R8467:Nup155	UTSW	15	8,151,015 (GRCm39)	missense	probably benign	0.00
R8507:Nup155	UTSW	15	8,177,044 (GRCm39)	nonsense	probably null
R8860:Nup155	UTSW	15	8,159,640 (GRCm39)	missense	possibly damaging	0.96
R8994:Nup155	UTSW	15	8,172,645 (GRCm39)	critical splice donor site	probably null
R9046:Nup155	UTSW	15	8,157,919 (GRCm39)	frame shift	probably null
R9086:Nup155	UTSW	15	8,177,830 (GRCm39)	missense	possibly damaging	0.84
R9500:Nup155	UTSW	15	8,141,800 (GRCm39)	missense	probably damaging	1.00
RF003:Nup155	UTSW	15	8,148,660 (GRCm39)	critical splice acceptor site	probably benign
RF048:Nup155	UTSW	15	8,148,660 (GRCm39)	critical splice acceptor site	probably benign
Z1177:Nup155	UTSW	15	8,149,973 (GRCm39)	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- GTCAATGAGTGACCTGAAGTCTTTCTCC -3'
(R):5'- GGGAACAGACCCAGCCTATAAGGTG -3'

Sequencing Primer
(F):5'- GACCTGAAGTCTTTCTCCTTACAG -3'
(R):5'- TGGACCCAGCTGAGCTTTTA -3'

Posted On

2013-11-18