Incidental Mutation 'R1072:Slc6a20b'
ID85507
Institutional Source Beutler Lab
Gene Symbol Slc6a20b
Ensembl Gene ENSMUSG00000025243
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 20B
SynonymsSit1, XT3, Xtrp3, Slc6a20
MMRRC Submission 039158-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R1072 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location123590800-123632565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123598459 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 462 (T462A)
Ref Sequence ENSEMBL: ENSMUSP00000150479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026273] [ENSMUST00000166800]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026273
AA Change: T462A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026273
Gene: ENSMUSG00000025243
AA Change: T462A

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
Pfam:SNF 48 624 5.4e-173 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166800
AA Change: T462A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000168824
SMART Domains Protein: ENSMUSP00000129307
Gene: ENSMUSG00000025243

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Pfam:SNF 38 74 3.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171122
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,212,769 F191Y probably benign Het
Ankrd55 G T 13: 112,348,842 A169S possibly damaging Het
Ano2 A G 6: 126,039,324 E940G probably damaging Het
Atp2c1 A T 9: 105,459,744 H153Q possibly damaging Het
Ccnf A T 17: 24,237,162 V283D probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Clec4b2 T C 6: 123,204,274 I206T probably damaging Het
Gli3 T C 13: 15,713,605 V535A probably damaging Het
Hectd1 A T 12: 51,761,072 D1779E probably benign Het
Itgax A G 7: 128,150,144 N1154D probably damaging Het
Klra10 A T 6: 130,281,848 H25Q probably benign Het
Lpo A G 11: 87,818,434 S94P probably damaging Het
Mbd5 A T 2: 49,257,191 N471I probably damaging Het
Myo5c A G 9: 75,292,208 Y1366C probably damaging Het
Nbea A G 3: 56,086,196 I261T possibly damaging Het
Nlrp4a T C 7: 26,444,435 F75S probably damaging Het
Numa1 T A 7: 102,001,150 probably null Het
Ppp3ca A G 3: 136,935,127 M480V probably benign Het
Ptpn23 A T 9: 110,386,595 M1367K probably benign Het
Rhobtb2 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 14: 69,787,527 probably benign Het
Sftpa1 C G 14: 41,133,635 probably null Het
Shank2 A T 7: 144,411,568 N1181I probably damaging Het
Spdye4c T C 2: 128,596,637 L305P probably benign Het
Th C A 7: 142,894,488 V275L probably benign Het
Ttn C T 2: 76,903,377 probably benign Het
Ush2a T C 1: 188,728,717 V2725A possibly damaging Het
Other mutations in Slc6a20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Slc6a20b APN 9 123597240 missense probably damaging 1.00
IGL02741:Slc6a20b APN 9 123607602 missense probably damaging 1.00
IGL03038:Slc6a20b APN 9 123597329 missense possibly damaging 0.55
IGL03115:Slc6a20b APN 9 123597338 missense possibly damaging 0.82
IGL03228:Slc6a20b APN 9 123632132 nonsense probably null
PIT4131001:Slc6a20b UTSW 9 123612126 missense probably benign 0.00
R0653:Slc6a20b UTSW 9 123597312 missense probably damaging 1.00
R1759:Slc6a20b UTSW 9 123608997 critical splice donor site probably null
R1889:Slc6a20b UTSW 9 123632204 missense probably benign 0.02
R2075:Slc6a20b UTSW 9 123595034 missense probably benign 0.13
R2187:Slc6a20b UTSW 9 123598588 missense probably damaging 1.00
R4097:Slc6a20b UTSW 9 123612757 utr 3 prime probably benign
R4762:Slc6a20b UTSW 9 123598560 missense probably damaging 1.00
R4834:Slc6a20b UTSW 9 123596048 missense probably benign 0.00
R4932:Slc6a20b UTSW 9 123604796 missense probably damaging 1.00
R5079:Slc6a20b UTSW 9 123598498 missense probably damaging 1.00
R5095:Slc6a20b UTSW 9 123595054 missense probably benign
R5307:Slc6a20b UTSW 9 123603834 missense possibly damaging 0.62
R5721:Slc6a20b UTSW 9 123611989 missense probably null 1.00
R6108:Slc6a20b UTSW 9 123596186 missense probably benign 0.01
R6285:Slc6a20b UTSW 9 123609096 missense possibly damaging 0.81
R6463:Slc6a20b UTSW 9 123604949 missense possibly damaging 0.62
R7050:Slc6a20b UTSW 9 123598543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGACTCCTAGAGCCTGCTTC -3'
(R):5'- TTACTTCAGCCCAGGTCCTGACAC -3'

Sequencing Primer
(F):5'- CTAGAGCCTGCTTCTGGAGTTG -3'
(R):5'- GGTCCTGACACTGAACACATTTG -3'
Posted On2013-11-18