Incidental Mutation 'R1072:Ccnf'
ID 85514
Institutional Source Beutler Lab
Gene Symbol Ccnf
Ensembl Gene ENSMUSG00000072082
Gene Name cyclin F
Synonyms CycF, Fbxo1
MMRRC Submission 039158-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1072 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 24441518-24470333 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24456136 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 283 (V283D)
Ref Sequence ENSEMBL: ENSMUSP00000111048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115390]
AlphaFold P51944
Predicted Effect probably damaging
Transcript: ENSMUST00000115390
AA Change: V283D

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111048
Gene: ENSMUSG00000072082
AA Change: V283D

DomainStartEndE-ValueType
FBOX 35 75 1.56e-6 SMART
CYCLIN 315 399 2.25e-13 SMART
Cyclin_C 408 531 2.58e-19 SMART
CYCLIN 416 494 2.27e-9 SMART
low complexity region 545 555 N/A INTRINSIC
low complexity region 563 574 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 719 731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184733
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin family. Cyclins are important regulators of cell cycle transitions through their ability to bind and activate cyclin-dependent protein kinases. This member also belongs to the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it was one of the first proteins in which the F-box motif was identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E9.5 and E10.5 due to defects in yolk sac and chorioallantoic placenta maturation. Embryos show incomplete turning, underdeveloped posterior structures, neural tube closure and braindefects. MEFs have cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,811,992 (GRCm39) F191Y probably benign Het
Ankrd55 G T 13: 112,485,376 (GRCm39) A169S possibly damaging Het
Ano2 A G 6: 126,016,287 (GRCm39) E940G probably damaging Het
Atp2c1 A T 9: 105,336,943 (GRCm39) H153Q possibly damaging Het
Cdh15 G A 8: 123,588,763 (GRCm39) R279Q probably damaging Het
Clec4b2 T C 6: 123,181,233 (GRCm39) I206T probably damaging Het
Gli3 T C 13: 15,888,190 (GRCm39) V535A probably damaging Het
Hectd1 A T 12: 51,807,855 (GRCm39) D1779E probably benign Het
Itgax A G 7: 127,749,316 (GRCm39) N1154D probably damaging Het
Klra10 A T 6: 130,258,811 (GRCm39) H25Q probably benign Het
Lpo A G 11: 87,709,260 (GRCm39) S94P probably damaging Het
Mbd5 A T 2: 49,147,203 (GRCm39) N471I probably damaging Het
Myo5c A G 9: 75,199,490 (GRCm39) Y1366C probably damaging Het
Nbea A G 3: 55,993,617 (GRCm39) I261T possibly damaging Het
Nlrp4a T C 7: 26,143,860 (GRCm39) F75S probably damaging Het
Numa1 T A 7: 101,650,357 (GRCm39) probably null Het
Ppp3ca A G 3: 136,640,888 (GRCm39) M480V probably benign Het
Ptpn23 A T 9: 110,215,663 (GRCm39) M1367K probably benign Het
Rhobtb2 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 14: 70,024,976 (GRCm39) probably benign Het
Sftpa1 C G 14: 40,855,592 (GRCm39) probably null Het
Shank2 A T 7: 143,965,305 (GRCm39) N1181I probably damaging Het
Slc6a20b T C 9: 123,427,524 (GRCm39) T462A probably damaging Het
Spdye4c T C 2: 128,438,557 (GRCm39) L305P probably benign Het
Th C A 7: 142,448,225 (GRCm39) V275L probably benign Het
Ttn C T 2: 76,733,721 (GRCm39) probably benign Het
Ush2a T C 1: 188,460,914 (GRCm39) V2725A possibly damaging Het
Other mutations in Ccnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Ccnf APN 17 24,443,986 (GRCm39) missense probably damaging 1.00
IGL01942:Ccnf APN 17 24,461,294 (GRCm39) missense probably benign 0.03
IGL02251:Ccnf APN 17 24,445,513 (GRCm39) missense probably benign 0.00
IGL02945:Ccnf APN 17 24,443,890 (GRCm39) missense probably damaging 0.99
IGL02952:Ccnf APN 17 24,450,299 (GRCm39) missense possibly damaging 0.93
albuquerque UTSW 17 24,442,971 (GRCm39) nonsense probably null
R0326:Ccnf UTSW 17 24,450,784 (GRCm39) missense possibly damaging 0.84
R0891:Ccnf UTSW 17 24,445,751 (GRCm39) missense possibly damaging 0.93
R1069:Ccnf UTSW 17 24,442,971 (GRCm39) nonsense probably null
R1693:Ccnf UTSW 17 24,445,514 (GRCm39) frame shift probably null
R2147:Ccnf UTSW 17 24,449,288 (GRCm39) critical splice donor site probably null
R3929:Ccnf UTSW 17 24,453,356 (GRCm39) missense probably damaging 1.00
R4081:Ccnf UTSW 17 24,442,872 (GRCm39) makesense probably null
R4260:Ccnf UTSW 17 24,445,741 (GRCm39) missense probably damaging 1.00
R4579:Ccnf UTSW 17 24,450,303 (GRCm39) nonsense probably null
R4651:Ccnf UTSW 17 24,450,760 (GRCm39) missense probably damaging 1.00
R4844:Ccnf UTSW 17 24,449,331 (GRCm39) nonsense probably null
R4876:Ccnf UTSW 17 24,449,311 (GRCm39) missense probably damaging 1.00
R5234:Ccnf UTSW 17 24,453,411 (GRCm39) nonsense probably null
R5352:Ccnf UTSW 17 24,462,247 (GRCm39) splice site probably null
R5845:Ccnf UTSW 17 24,459,767 (GRCm39) missense possibly damaging 0.95
R6084:Ccnf UTSW 17 24,450,811 (GRCm39) missense probably damaging 1.00
R6219:Ccnf UTSW 17 24,445,678 (GRCm39) nonsense probably null
R7021:Ccnf UTSW 17 24,461,205 (GRCm39) missense probably damaging 1.00
R7176:Ccnf UTSW 17 24,468,376 (GRCm39) missense possibly damaging 0.54
R7180:Ccnf UTSW 17 24,442,889 (GRCm39) missense probably benign 0.00
R7485:Ccnf UTSW 17 24,468,232 (GRCm39) missense probably damaging 0.97
R7763:Ccnf UTSW 17 24,443,986 (GRCm39) missense probably damaging 1.00
R8016:Ccnf UTSW 17 24,450,784 (GRCm39) missense possibly damaging 0.84
R8034:Ccnf UTSW 17 24,450,805 (GRCm39) missense probably damaging 1.00
R8069:Ccnf UTSW 17 24,443,989 (GRCm39) missense probably damaging 1.00
R9021:Ccnf UTSW 17 24,445,679 (GRCm39) nonsense probably null
R9623:Ccnf UTSW 17 24,468,367 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGAGAGACCCTGCCTTATTG -3'
(R):5'- TTAGCCATGCTGCTAAGGAAGCCC -3'

Sequencing Primer
(F):5'- AGAGACCCTGCCTTATTGAATGC -3'
(R):5'- CTAAGGAAGCCCAGGCTG -3'
Posted On 2013-11-18