Incidental Mutation 'R1073:Ncl'
ID85516
Institutional Source Beutler Lab
Gene Symbol Ncl
Ensembl Gene ENSMUSG00000026234
Gene Namenucleolin
SynonymsB530004O11Rik, C23
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R1073 (G1)
Quality Score217
Status Validated
Chromosome1
Chromosomal Location86344719-86359400 bp(-) (GRCm38)
Type of Mutationsmall insertion (3 aa in frame mutation)
DNA Base Change (assembly) AAAGCCTCCC to AAAGCCTCCCAAGCCTCCC at 86350816 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027438]
Predicted Effect probably benign
Transcript: ENSMUST00000027438
SMART Domains Protein: ENSMUSP00000027438
Gene: ENSMUSG00000026234

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
low complexity region 51 66 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 121 142 N/A INTRINSIC
low complexity region 143 168 N/A INTRINSIC
low complexity region 178 188 N/A INTRINSIC
low complexity region 189 215 N/A INTRINSIC
low complexity region 241 273 N/A INTRINSIC
low complexity region 288 299 N/A INTRINSIC
RRM 310 381 2.1e-8 SMART
RRM 396 464 1.97e-13 SMART
RRM 488 557 4.56e-18 SMART
RRM 570 640 1.04e-21 SMART
low complexity region 648 695 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082762
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197651
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleolin (NCL), a eukaryotic nucleolar phosphoprotein, is involved in the synthesis and maturation of ribosomes. It is located mainly in dense fibrillar regions of the nucleolus. Human NCL gene consists of 14 exons with 13 introns and spans approximately 11kb. The intron 11 of the NCL gene encodes a small nucleolar RNA, termed U20. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Msrb3 T A 10: 120,784,136 S93C possibly damaging Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Ncl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ncl APN 1 86356369 critical splice donor site probably null
IGL03328:Ncl APN 1 86352597 missense probably damaging 1.00
PIT4498001:Ncl UTSW 1 86351440 missense possibly damaging 0.61
R0348:Ncl UTSW 1 86356640 missense possibly damaging 0.86
R2021:Ncl UTSW 1 86356955 critical splice donor site probably null
R2022:Ncl UTSW 1 86356955 critical splice donor site probably null
R4672:Ncl UTSW 1 86356602 missense probably benign 0.04
R4900:Ncl UTSW 1 86356179 missense probably benign 0.01
R6028:Ncl UTSW 1 86356133 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTCTTGCCAAGCTCTTAAGCAAC -3'
(R):5'- TGAGGAAGATGCCAAAGCTGCC -3'

Sequencing Primer
(F):5'- GGCTCTGTCATTGAACAGGTAAC -3'
(R):5'- GCCAAAGCTGCCAAGGAG -3'
Posted On2013-11-18