Incidental Mutation 'R1073:Msrb3'
ID85537
Institutional Source Beutler Lab
Gene Symbol Msrb3
Ensembl Gene ENSMUSG00000051236
Gene Namemethionine sulfoxide reductase B3
Synonyms
MMRRC Submission 039159-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1073 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location120781096-120899101 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120784136 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 93 (S93C)
Ref Sequence ENSEMBL: ENSMUSP00000115269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092143] [ENSMUST00000130950]
Predicted Effect probably benign
Transcript: ENSMUST00000092143
AA Change: S165C

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000089781
Gene: ENSMUSG00000051236
AA Change: S165C

DomainStartEndE-ValueType
Pfam:SelR 41 161 1.9e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130950
AA Change: S93C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115269
Gene: ENSMUSG00000051236
AA Change: S93C

DomainStartEndE-ValueType
Pfam:SelR 20 90 7.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139961
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.5%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of methionine sulfoxide to methionine. This enzyme acts as a monomer and requires zinc as a cofactor. Several transcript variants encoding two different isoforms have been found for this gene. One of the isoforms localizes to mitochondria while the other localizes to endoplasmic reticula. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit deafness with cochlear inner and outer hair cell degeneration and increased apoptosis in the organ of Corti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asap3 T C 4: 136,236,431 I334T probably damaging Het
Atxn7l3 C G 11: 102,292,435 probably benign Het
Cacna2d3 T A 14: 29,045,623 H765L probably damaging Het
Cngb1 A G 8: 95,303,567 probably null Het
Csmd1 C T 8: 16,358,463 probably benign Het
Cux1 A T 5: 136,252,541 probably null Het
D7Ertd443e T C 7: 134,270,218 K232R probably damaging Het
Dock6 A G 9: 21,846,518 S97P probably benign Het
Eml5 G A 12: 98,830,973 A1099V probably damaging Het
Gtf2h1 G A 7: 46,816,944 A472T probably damaging Het
Krt82 T A 15: 101,550,254 D117V probably damaging Het
Lrfn5 A G 12: 61,840,809 Y461C probably damaging Het
Mkl2 T A 16: 13,412,318 S956T possibly damaging Het
Mmrn2 G A 14: 34,396,294 probably null Het
Ncl AAAGCCTCCC AAAGCCTCCCAAGCCTCCC 1: 86,350,816 probably benign Het
Olfr228 A G 2: 86,483,640 I34T probably damaging Het
Osbpl10 C T 9: 115,207,553 Q381* probably null Het
Pelp1 A G 11: 70,396,590 L464P probably damaging Het
Pigs A G 11: 78,335,605 D216G probably benign Het
Ptprk T C 10: 28,496,947 probably null Het
Pyroxd1 T C 6: 142,348,644 probably null Het
Ros1 T A 10: 52,046,125 D2284V probably damaging Het
Rptor T C 11: 119,743,891 S178P possibly damaging Het
Slc8a1 C T 17: 81,648,407 D401N probably damaging Het
Tas2r143 T C 6: 42,400,760 Y175H probably benign Het
Tdrd9 T C 12: 112,023,259 S502P probably damaging Het
Tmem38a A G 8: 72,580,103 H142R probably damaging Het
Tmem44 A G 16: 30,514,833 probably benign Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Umod A G 7: 119,464,741 V614A possibly damaging Het
Vmn2r5 A T 3: 64,491,305 L751* probably null Het
Wdr37 A T 13: 8,805,840 I489N probably damaging Het
Xdh T C 17: 73,939,836 T78A probably benign Het
Zfp866 A T 8: 69,767,622 probably benign Het
Other mutations in Msrb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Msrb3 APN 10 120850001 missense possibly damaging 0.94
IGL03303:Msrb3 APN 10 120784141 missense probably benign 0.03
R0138:Msrb3 UTSW 10 120851987 missense probably damaging 1.00
R1946:Msrb3 UTSW 10 120852008 missense probably damaging 1.00
R2113:Msrb3 UTSW 10 120852080 missense possibly damaging 0.66
R3623:Msrb3 UTSW 10 120784198 missense probably damaging 1.00
R3741:Msrb3 UTSW 10 120784214 missense probably damaging 1.00
R4606:Msrb3 UTSW 10 120849997 missense probably damaging 1.00
R6397:Msrb3 UTSW 10 120791451 missense probably damaging 1.00
R6875:Msrb3 UTSW 10 120784106 missense probably benign 0.13
R7207:Msrb3 UTSW 10 120791400 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCACAAAGCCATCTCCGTTTGC -3'
(R):5'- GGTACAAAGTCTGTCTGGAGCCATC -3'

Sequencing Primer
(F):5'- agagagagagaaagagagagagag -3'
(R):5'- TCTTCAGCTATTGACAGGCAG -3'
Posted On2013-11-18