Incidental Mutation 'R1074:Catsperg1'
ID85570
Institutional Source Beutler Lab
Gene Symbol Catsperg1
Ensembl Gene ENSMUSG00000049676
Gene Namecation channel sperm associated auxiliary subunit gamma 1
SynonymsA230107C01Rik, Catsperg
MMRRC Submission 039160-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1074 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29181321-29214035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29206849 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 143 (E143G)
Ref Sequence ENSEMBL: ENSMUSP00000129837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047846] [ENSMUST00000069861] [ENSMUST00000163782] [ENSMUST00000164653] [ENSMUST00000169143]
Predicted Effect probably damaging
Transcript: ENSMUST00000047846
AA Change: E143G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045233
Gene: ENSMUSG00000049676
AA Change: E143G

DomainStartEndE-ValueType
Pfam:CATSPERG 1 920 N/A PFAM
transmembrane domain 1012 1034 N/A INTRINSIC
low complexity region 1058 1073 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069861
SMART Domains Protein: ENSMUSP00000067388
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 57 7.9e-14 PFAM
Pfam:CATSPERG 73 205 7e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163614
Predicted Effect possibly damaging
Transcript: ENSMUST00000163782
AA Change: E70G

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127409
Gene: ENSMUSG00000049676
AA Change: E70G

DomainStartEndE-ValueType
Pfam:CATSPERG 1 93 1.7e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164653
SMART Domains Protein: ENSMUSP00000131827
Gene: ENSMUSG00000049676

DomainStartEndE-ValueType
Pfam:CATSPERG 1 111 1.4e-44 PFAM
Pfam:CATSPERG 108 334 8.5e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167064
Predicted Effect probably damaging
Transcript: ENSMUST00000169143
AA Change: E143G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129837
Gene: ENSMUSG00000049676
AA Change: E143G

DomainStartEndE-ValueType
Pfam:CATSPERG 2 973 N/A PFAM
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1111 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172226
Meta Mutation Damage Score 0.222 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T C 1: 26,683,226 K958E probably benign Het
Aak1 T C 6: 86,935,439 S98P probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acbd3 C T 1: 180,738,548 Q269* probably null Het
Ankrd6 T C 4: 32,822,232 H179R probably damaging Het
Ano1 T A 7: 144,611,680 N603Y probably damaging Het
Epha5 G T 5: 84,150,395 A383E probably damaging Het
Epha5 C T 5: 84,150,396 A383T probably damaging Het
Epn1 T C 7: 5,095,048 V286A probably benign Het
Fam117b C T 1: 59,958,326 A279V possibly damaging Het
Gm15448 T C 7: 3,823,070 D308G probably damaging Het
Impg2 G A 16: 56,265,178 probably benign Het
Man1a2 C T 3: 100,656,086 R81H possibly damaging Het
Medag G T 5: 149,412,209 V78L probably benign Het
Meioc C T 11: 102,675,393 H612Y probably damaging Het
Nab2 G A 10: 127,663,255 Q385* probably null Het
Ncor1 A G 11: 62,392,551 F437L probably damaging Het
Olfr134 T C 17: 38,175,440 S119P probably damaging Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Olfr796 T C 10: 129,608,466 N5S probably damaging Het
Pcdhga1 A G 18: 37,825,087 probably benign Het
Pik3c2a G A 7: 116,350,925 R1286* probably null Het
Plk3 T C 4: 117,131,758 E268G probably damaging Het
Pzp T A 6: 128,487,924 N1329I probably benign Het
Reps1 A G 10: 18,094,446 T264A probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Srarp T A 4: 141,433,396 D42V probably damaging Het
Srbd1 T A 17: 86,003,952 H679L probably damaging Het
Tbc1d2b G A 9: 90,222,340 P583L possibly damaging Het
Vmn2r22 T C 6: 123,649,258 D73G probably benign Het
Zfp512b A T 2: 181,589,179 S374R probably damaging Het
Other mutations in Catsperg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Catsperg1 APN 7 29198146 missense probably damaging 1.00
IGL01693:Catsperg1 APN 7 29185098 unclassified probably benign
IGL01935:Catsperg1 APN 7 29195871 unclassified probably null
IGL02484:Catsperg1 APN 7 29210920 start gained probably benign
IGL02584:Catsperg1 APN 7 29184721 missense probably damaging 1.00
IGL02880:Catsperg1 APN 7 29195485 missense possibly damaging 0.75
IGL03268:Catsperg1 APN 7 29200243 missense probably damaging 1.00
IGL03285:Catsperg1 APN 7 29198172 missense possibly damaging 0.89
solid UTSW 7 29190298 nonsense probably null
K7894:Catsperg1 UTSW 7 29197154 intron probably benign
R0180:Catsperg1 UTSW 7 29190431 splice site probably null
R0344:Catsperg1 UTSW 7 29195540 missense probably damaging 1.00
R0523:Catsperg1 UTSW 7 29185190 unclassified probably benign
R0561:Catsperg1 UTSW 7 29182312 missense probably damaging 1.00
R0610:Catsperg1 UTSW 7 29190619 missense probably damaging 1.00
R0762:Catsperg1 UTSW 7 29189952 missense probably benign 0.03
R1201:Catsperg1 UTSW 7 29191670 missense possibly damaging 0.77
R1346:Catsperg1 UTSW 7 29182334 splice site probably null
R1387:Catsperg1 UTSW 7 29206864 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1467:Catsperg1 UTSW 7 29185008 missense probably damaging 1.00
R1486:Catsperg1 UTSW 7 29185495 missense probably damaging 1.00
R1883:Catsperg1 UTSW 7 29182236 critical splice donor site probably null
R1932:Catsperg1 UTSW 7 29198143 missense probably damaging 1.00
R1942:Catsperg1 UTSW 7 29206807 missense possibly damaging 0.89
R2127:Catsperg1 UTSW 7 29185040 missense probably damaging 1.00
R2205:Catsperg1 UTSW 7 29185246 nonsense probably null
R4214:Catsperg1 UTSW 7 29195932 missense possibly damaging 0.80
R4678:Catsperg1 UTSW 7 29190296 missense probably benign 0.13
R5008:Catsperg1 UTSW 7 29195434 nonsense probably null
R5217:Catsperg1 UTSW 7 29190298 nonsense probably null
R5268:Catsperg1 UTSW 7 29195247 missense probably benign 0.41
R5372:Catsperg1 UTSW 7 29210712 missense probably benign 0.08
R5393:Catsperg1 UTSW 7 29185499 missense probably damaging 1.00
R5406:Catsperg1 UTSW 7 29185523 missense probably damaging 1.00
R5557:Catsperg1 UTSW 7 29195871 missense possibly damaging 0.89
R5921:Catsperg1 UTSW 7 29190523 missense possibly damaging 0.78
R5928:Catsperg1 UTSW 7 29206615 missense probably damaging 0.99
R5960:Catsperg1 UTSW 7 29184783 unclassified probably benign
R6053:Catsperg1 UTSW 7 29210814 nonsense probably null
R6144:Catsperg1 UTSW 7 29210695 missense probably damaging 0.99
R6215:Catsperg1 UTSW 7 29200239 missense probably damaging 1.00
R6334:Catsperg1 UTSW 7 29206357 missense probably benign 0.01
R6446:Catsperg1 UTSW 7 29206567 missense probably benign 0.00
R6854:Catsperg1 UTSW 7 29181702 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GAGTGTGCCCACTACCAGAAACAG -3'
(R):5'- AGCTCCAGGTGTAGGACATTACTCC -3'

Sequencing Primer
(F):5'- TGTACCAGTTCAGGATGCAC -3'
(R):5'- TAGGACATTACTCCAGGGGTC -3'
Posted On2013-11-18