Incidental Mutation 'R1076:Ulk2'
ID85659
Institutional Source Beutler Lab
Gene Symbol Ulk2
Ensembl Gene ENSMUSG00000004798
Gene Nameunc-51 like kinase 2
SynonymsUnc51.2, A830085I22Rik
MMRRC Submission 039162-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R1076 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location61775649-61855073 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 61819309 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 358 (H358Y)
Ref Sequence ENSEMBL: ENSMUSP00000004920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004920]
Predicted Effect probably damaging
Transcript: ENSMUST00000004920
AA Change: H358Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000004920
Gene: ENSMUSG00000004798
AA Change: H358Y

DomainStartEndE-ValueType
S_TKc 9 271 1.1e-93 SMART
low complexity region 274 309 N/A INTRINSIC
Blast:S_TKc 310 413 9e-28 BLAST
Blast:S_TKc 433 738 1e-29 BLAST
low complexity region 751 766 N/A INTRINSIC
low complexity region 771 791 N/A INTRINSIC
Pfam:DUF3543 821 1032 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129025
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutation of this gene results in an increased anxiety-like response in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ang4 T C 14: 51,764,302 K63R probably damaging Het
Ankrd50 T C 3: 38,454,922 N176D probably damaging Het
Apbb1 A T 7: 105,573,855 L183Q probably benign Het
BC049730 A G 7: 24,713,742 K162R probably benign Het
Cdh17 T C 4: 11,795,581 V387A probably benign Het
Cldn4 A G 5: 134,946,337 S137P probably damaging Het
Cnn1 A T 9: 22,107,869 Q157L probably damaging Het
Csn1s1 A T 5: 87,676,383 probably null Het
Dennd3 C T 15: 73,540,733 H415Y probably damaging Het
Dnpep A G 1: 75,315,938 probably benign Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Elovl2 A G 13: 41,190,107 V115A possibly damaging Het
Fryl C T 5: 73,124,673 probably benign Het
Gsap A G 5: 21,287,694 T707A possibly damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Ktn1 T A 14: 47,694,638 M674K probably damaging Het
Larp4 A G 15: 99,997,430 T295A probably benign Het
Lrp1 T C 10: 127,563,797 probably benign Het
Macf1 T C 4: 123,385,598 D3870G probably damaging Het
Mctp2 T G 7: 72,185,867 probably null Het
Nbn A T 4: 15,970,719 probably null Het
Neb A G 2: 52,204,892 Y4883H probably damaging Het
Nsun6 A T 2: 15,009,472 C286S probably benign Het
Pabpc4 T A 4: 123,292,908 D307E possibly damaging Het
Pik3cg G A 12: 32,195,714 probably benign Het
Ptpdc1 C T 13: 48,586,810 E382K probably damaging Het
Serpina3k A G 12: 104,340,994 T162A probably benign Het
Sis T C 3: 72,934,098 T795A probably damaging Het
Skint8 T A 4: 111,927,219 V14E probably damaging Het
Slc2a1 T G 4: 119,134,448 M351R probably damaging Het
Slc41a3 G A 6: 90,644,160 C394Y probably benign Het
Srp54b T C 12: 55,255,528 probably benign Het
Utp20 A G 10: 88,772,459 M1572T probably benign Het
Utp20 A T 10: 88,772,543 I1544N possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Other mutations in Ulk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Ulk2 APN 11 61791436 nonsense probably null
IGL02044:Ulk2 APN 11 61781639 missense probably damaging 1.00
IGL02185:Ulk2 APN 11 61782060 missense probably damaging 1.00
IGL03036:Ulk2 APN 11 61834834 missense probably damaging 1.00
R0207:Ulk2 UTSW 11 61777785 missense probably benign 0.42
R0362:Ulk2 UTSW 11 61787586 missense probably benign
R0657:Ulk2 UTSW 11 61808054 splice site probably benign
R1144:Ulk2 UTSW 11 61800060 missense possibly damaging 0.80
R1573:Ulk2 UTSW 11 61779755 missense probably damaging 1.00
R1583:Ulk2 UTSW 11 61783545 missense possibly damaging 0.95
R1619:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R1757:Ulk2 UTSW 11 61841339 splice site probably benign
R1845:Ulk2 UTSW 11 61812738 missense probably benign 0.04
R1883:Ulk2 UTSW 11 61830612 missense probably damaging 1.00
R1966:Ulk2 UTSW 11 61819471 splice site probably null
R2177:Ulk2 UTSW 11 61791509 missense probably benign 0.01
R2416:Ulk2 UTSW 11 61782039 missense probably damaging 1.00
R2509:Ulk2 UTSW 11 61787514 missense probably benign 0.00
R2847:Ulk2 UTSW 11 61824729 critical splice acceptor site probably null
R4736:Ulk2 UTSW 11 61833435 missense probably damaging 1.00
R4997:Ulk2 UTSW 11 61799156 missense probably benign 0.00
R5081:Ulk2 UTSW 11 61803662 missense probably damaging 1.00
R5190:Ulk2 UTSW 11 61781711 missense probably benign
R5346:Ulk2 UTSW 11 61834914 missense probably damaging 1.00
R5348:Ulk2 UTSW 11 61783613 missense probably benign
R5520:Ulk2 UTSW 11 61808144 missense probably damaging 1.00
R5954:Ulk2 UTSW 11 61803796 splice site probably benign
R6153:Ulk2 UTSW 11 61781746 missense probably damaging 1.00
R6223:Ulk2 UTSW 11 61787504 nonsense probably null
X0028:Ulk2 UTSW 11 61799568 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGGATTCCCTCCCAAACTTACT -3'
(R):5'- GCAAGGCCATGAGCTGGGAC -3'

Sequencing Primer
(F):5'- acacccataataatcccaggac -3'
(R):5'- aaaaaaCTTAGCTTCTCCAAAGTTTC -3'
Posted On2013-11-18