Incidental Mutation 'R1078:Tcf7l2'
ID85763
Institutional Source Beutler Lab
Gene Symbol Tcf7l2
Ensembl Gene ENSMUSG00000024985
Gene Nametranscription factor 7 like 2, T cell specific, HMG box
SynonymsTCF4B, mTcf-4B, mTcf-4E, TCF4E, Tcf4, Tcf-4
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1078 (G1)
Quality Score154
Status Not validated
Chromosome19
Chromosomal Location55741810-55933654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55743195 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 127 (T127A)
Ref Sequence ENSEMBL: ENSMUSP00000107286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041717] [ENSMUST00000061496] [ENSMUST00000111649] [ENSMUST00000111651] [ENSMUST00000111652] [ENSMUST00000111653] [ENSMUST00000111654] [ENSMUST00000111656] [ENSMUST00000111657] [ENSMUST00000111658] [ENSMUST00000111659] [ENSMUST00000111662] [ENSMUST00000153888]
Predicted Effect probably benign
Transcript: ENSMUST00000041717
AA Change: T127A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042950
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061496
AA Change: T127A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000050081
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111649
AA Change: T127A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107276
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111651
AA Change: T127A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000107278
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 284 2.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111652
AA Change: T127A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107279
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 9.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111653
AA Change: T127A

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107280
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111654
AA Change: T127A

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107281
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.2e-93 PFAM
HMG 345 415 1.16e-22 SMART
low complexity region 421 429 N/A INTRINSIC
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111656
AA Change: T127A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107283
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 458 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111657
AA Change: T127A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107284
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 468 2.08e-14 SMART
low complexity region 471 498 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111658
AA Change: T127A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107286
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.5e-93 PFAM
HMG 350 420 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111659
AA Change: T127A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107287
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-96 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111662
AA Change: T127A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107291
Gene: ENSMUSG00000024985
AA Change: T127A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-103 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 421 442 1.23e-2 SMART
c-clamp 446 476 1.35e-13 SMART
low complexity region 479 506 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126434
Predicted Effect unknown
Transcript: ENSMUST00000127233
AA Change: T119A
SMART Domains Protein: ENSMUSP00000123428
Gene: ENSMUSG00000024985
AA Change: T119A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 229 9.3e-98 PFAM
HMG 319 389 1.16e-22 SMART
low complexity region 395 403 N/A INTRINSIC
c-clamp 414 434 2.25e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133008
Predicted Effect probably benign
Transcript: ENSMUST00000153888
AA Change: T85A

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000118661
Gene: ENSMUSG00000024985
AA Change: T85A

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 217 1.2e-64 PFAM
HMG 307 377 1.16e-22 SMART
low complexity region 383 391 N/A INTRINSIC
c-clamp 402 432 5.29e-7 SMART
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit intestinal epithelia abnormalities and die shortly after birth. Mice heterozygous for some mutations display abnormalities in glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Tcf7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Tcf7l2 APN 19 55917421 missense probably damaging 1.00
IGL01013:Tcf7l2 APN 19 55919627 splice site probably benign
IGL02871:Tcf7l2 APN 19 55918997 missense probably damaging 1.00
banned UTSW 19 55931432 critical splice acceptor site probably null
PIT4468001:Tcf7l2 UTSW 19 55742388 missense probably damaging 1.00
R0927:Tcf7l2 UTSW 19 55918955 missense probably damaging 1.00
R4580:Tcf7l2 UTSW 19 55919036 missense probably damaging 1.00
R4721:Tcf7l2 UTSW 19 55931454 missense possibly damaging 0.89
R4814:Tcf7l2 UTSW 19 55924072 nonsense probably null
R4957:Tcf7l2 UTSW 19 55931432 critical splice acceptor site probably null
R5222:Tcf7l2 UTSW 19 55898612 missense probably benign
R5484:Tcf7l2 UTSW 19 55919508 splice site probably null
R5808:Tcf7l2 UTSW 19 55908541 missense probably damaging 1.00
R5914:Tcf7l2 UTSW 19 55898560 missense probably benign 0.00
R6077:Tcf7l2 UTSW 19 55917436 nonsense probably null
R6116:Tcf7l2 UTSW 19 55919014 missense probably damaging 1.00
R6861:Tcf7l2 UTSW 19 55742523 missense probably damaging 1.00
R6970:Tcf7l2 UTSW 19 55755048 missense probably benign 0.44
R7009:Tcf7l2 UTSW 19 55894733 critical splice donor site probably null
R7382:Tcf7l2 UTSW 19 55926740 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCTGCGAAAACTTGTAACCGTG -3'
(R):5'- GTTCAGATTGGCACCCCAACAGAG -3'

Sequencing Primer
(F):5'- ctcggggggACACTTGC -3'
(R):5'- AAAGGCTCCCCGAATCGTG -3'
Posted On2013-11-18