Incidental Mutation 'R1079:Dennd4b'
ID85775
Institutional Source Beutler Lab
Gene Symbol Dennd4b
Ensembl Gene ENSMUSG00000042404
Gene NameDENN/MADD domain containing 4B
Synonyms
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90265185-90280669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90271178 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 516 (R516K)
Ref Sequence ENSEMBL: ENSMUSP00000117354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098914] [ENSMUST00000129564]
Predicted Effect probably benign
Transcript: ENSMUST00000098914
AA Change: R527K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096514
Gene: ENSMUSG00000042404
AA Change: R527K

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
uDENN 183 290 1.15e-29 SMART
DENN 324 508 5.26e-70 SMART
dDENN 573 647 1.75e-25 SMART
low complexity region 672 690 N/A INTRINSIC
low complexity region 740 752 N/A INTRINSIC
coiled coil region 902 928 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1131 1148 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1424 1439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129564
AA Change: R516K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117354
Gene: ENSMUSG00000042404
AA Change: R516K

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
uDENN 172 279 1.15e-29 SMART
DENN 313 497 5.26e-70 SMART
dDENN 562 636 1.75e-25 SMART
low complexity region 661 679 N/A INTRINSIC
low complexity region 729 741 N/A INTRINSIC
coiled coil region 891 917 N/A INTRINSIC
low complexity region 1011 1027 N/A INTRINSIC
low complexity region 1075 1085 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1120 1137 N/A INTRINSIC
low complexity region 1327 1339 N/A INTRINSIC
low complexity region 1413 1428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138376
SMART Domains Protein: ENSMUSP00000116003
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
coiled coil region 29 55 N/A INTRINSIC
low complexity region 148 164 N/A INTRINSIC
low complexity region 212 222 N/A INTRINSIC
low complexity region 240 253 N/A INTRINSIC
low complexity region 257 264 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151648
SMART Domains Protein: ENSMUSP00000121350
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
uDENN 2 57 3.71e-6 SMART
Pfam:DENN 91 157 2.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156358
SMART Domains Protein: ENSMUSP00000118483
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Blast:uDENN 39 97 9e-6 BLAST
Blast:uDENN 164 207 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183900
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Dennd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dennd4b APN 3 90271207 missense possibly damaging 0.83
IGL00834:Dennd4b APN 3 90279686 critical splice donor site probably null
IGL01124:Dennd4b APN 3 90269074 missense possibly damaging 0.61
IGL01792:Dennd4b APN 3 90279845 missense probably damaging 0.96
IGL01895:Dennd4b APN 3 90275567 missense probably benign 0.00
IGL02533:Dennd4b APN 3 90272310 missense probably benign 0.02
IGL02630:Dennd4b APN 3 90272977 missense probably benign 0.00
R0107:Dennd4b UTSW 3 90272736 missense possibly damaging 0.92
R0143:Dennd4b UTSW 3 90272364 missense probably damaging 1.00
R1306:Dennd4b UTSW 3 90271165 missense probably benign 0.00
R1525:Dennd4b UTSW 3 90270870 missense probably damaging 0.97
R1756:Dennd4b UTSW 3 90271605 missense probably damaging 1.00
R1959:Dennd4b UTSW 3 90268773 missense probably damaging 1.00
R1976:Dennd4b UTSW 3 90273055 missense probably damaging 1.00
R2184:Dennd4b UTSW 3 90275540 missense probably damaging 1.00
R2296:Dennd4b UTSW 3 90275514 missense probably damaging 1.00
R2406:Dennd4b UTSW 3 90275488 missense probably damaging 1.00
R2408:Dennd4b UTSW 3 90271575 nonsense probably null
R4691:Dennd4b UTSW 3 90272312 missense probably damaging 1.00
R5376:Dennd4b UTSW 3 90278056 missense probably benign 0.00
R5466:Dennd4b UTSW 3 90268500 splice site probably null
R5555:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5556:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5557:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5605:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5617:Dennd4b UTSW 3 90275626 missense probably benign
R5692:Dennd4b UTSW 3 90277783 missense probably damaging 1.00
R5790:Dennd4b UTSW 3 90277450 missense probably damaging 1.00
R5957:Dennd4b UTSW 3 90270965 missense probably damaging 1.00
R6130:Dennd4b UTSW 3 90276259 missense probably damaging 1.00
R6183:Dennd4b UTSW 3 90275568 utr 3 prime probably benign
R6505:Dennd4b UTSW 3 90267611 missense probably damaging 1.00
R6631:Dennd4b UTSW 3 90277732 splice site probably null
R6801:Dennd4b UTSW 3 90268779 missense probably damaging 0.98
R7409:Dennd4b UTSW 3 90273952 missense probably benign 0.15
R7457:Dennd4b UTSW 3 90269315 missense probably benign
X0024:Dennd4b UTSW 3 90270971 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CAGATGATCTTCCCTCTGCATTGGC -3'
(R):5'- GCTCAGAAATGCTGCTTCCCCTAC -3'

Sequencing Primer
(F):5'- CGCTCTTCCAGTAAGAGGCTAAG -3'
(R):5'- ACCCCTGCTCCTAGCTTC -3'
Posted On2013-11-18