Incidental Mutation 'R1079:Kif3a'
ID85791
Institutional Source Beutler Lab
Gene Symbol Kif3a
Ensembl Gene ENSMUSG00000018395
Gene Namekinesin family member 3A
SynonymsKns3, kinesin-II subunit, N-4 kinesin, Kif3, Kifl
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location53567379-53601967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 53570581 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 17 (V17L)
Ref Sequence ENSEMBL: ENSMUSP00000115161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057330] [ENSMUST00000118353] [ENSMUST00000120613] [ENSMUST00000132496] [ENSMUST00000173744]
Predicted Effect probably benign
Transcript: ENSMUST00000057330
AA Change: V18L

PolyPhen 2 Score 0.376 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056197
Gene: ENSMUSG00000018395
AA Change: V18L

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
coiled coil region 416 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118353
AA Change: V18L

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113848
Gene: ENSMUSG00000018395
AA Change: V18L

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 418 N/A INTRINSIC
coiled coil region 443 620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120613
AA Change: V18L

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112782
Gene: ENSMUSG00000018395
AA Change: V18L

DomainStartEndE-ValueType
KISc 12 353 4.6e-189 SMART
coiled coil region 354 383 N/A INTRINSIC
coiled coil region 419 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132496
AA Change: V17L

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115161
Gene: ENSMUSG00000018395
AA Change: V17L

DomainStartEndE-ValueType
KISc 11 178 4.96e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155165
Predicted Effect possibly damaging
Transcript: ENSMUST00000173744
AA Change: V18L

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133432
Gene: ENSMUSG00000018395
AA Change: V18L

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 406 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
low complexity region 498 526 N/A INTRINSIC
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Nullizygous mutations result in embryonic lethality, failure to synthesize cilia in the embryonic node, randomization of left-right asymmetry and structural abnormalities of the neural tube, pericardium, branchial arches, and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Kif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Kif3a APN 11 53593523 missense possibly damaging 0.53
IGL01862:Kif3a APN 11 53570541 missense possibly damaging 0.63
IGL02411:Kif3a APN 11 53570698 missense probably damaging 1.00
PIT4453001:Kif3a UTSW 11 53579114 missense probably benign 0.16
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0078:Kif3a UTSW 11 53578985 missense probably benign 0.22
R0131:Kif3a UTSW 11 53586916 missense possibly damaging 0.53
R1168:Kif3a UTSW 11 53598312 missense probably damaging 1.00
R1554:Kif3a UTSW 11 53598327 missense probably damaging 0.98
R1817:Kif3a UTSW 11 53598734 missense probably damaging 1.00
R2022:Kif3a UTSW 11 53570581 missense probably damaging 1.00
R2964:Kif3a UTSW 11 53578930 missense probably damaging 1.00
R3861:Kif3a UTSW 11 53597978 missense probably benign 0.33
R3928:Kif3a UTSW 11 53570614 missense probably benign 0.02
R4553:Kif3a UTSW 11 53578918 missense possibly damaging 0.93
R5158:Kif3a UTSW 11 53588751 missense probably benign
R5437:Kif3a UTSW 11 53598726 missense probably damaging 0.99
R6621:Kif3a UTSW 11 53579130 missense probably damaging 1.00
R7028:Kif3a UTSW 11 53586906 nonsense probably null
R7384:Kif3a UTSW 11 53578854 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGTCTTAGCACATCCGGGATGC -3'
(R):5'- GCTCATCAAGCCATAGCTGCGATAC -3'

Sequencing Primer
(F):5'- ACATCCGGGATGCTGAGG -3'
(R):5'- CGTAAACTACCGATTTTACCGGG -3'
Posted On2013-11-18