Incidental Mutation 'R1079:Baz1a'
ID85795
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Namebromodomain adjacent to zinc finger domain 1A
SynonymsWcrf180, Acf1, Gtl5
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location54892989-55014348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54895000 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1474 (I1474L)
Ref Sequence ENSEMBL: ENSMUSP00000133478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038926
AA Change: I1477L

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: I1477L

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173433
AA Change: I1474L

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: I1474L

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173453
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54916731 missense probably benign
IGL01138:Baz1a APN 12 54930325 missense probably damaging 1.00
IGL01298:Baz1a APN 12 54954809 missense probably damaging 1.00
IGL02639:Baz1a APN 12 54896025 splice site probably benign
IGL02995:Baz1a APN 12 54900447 missense probably damaging 1.00
IGL03001:Baz1a APN 12 54923111 missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54894958 missense probably damaging 1.00
IGL03135:Baz1a APN 12 54929590 missense probably damaging 1.00
IGL03151:Baz1a APN 12 54909149 critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54898535 missense probably damaging 1.00
IGL03240:Baz1a APN 12 54927567 nonsense probably null
flavia UTSW 12 54975308 missense probably damaging 1.00
gumdrops UTSW 12 54900448 missense probably damaging 1.00
Kilter UTSW 12 54900532 missense probably damaging 0.99
Kisses UTSW 12 54975137 missense probably damaging 1.00
Smootch UTSW 12 54911385 missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54930310 missense probably benign 0.03
R0127:Baz1a UTSW 12 54898706 missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54911387 missense probably damaging 1.00
R0393:Baz1a UTSW 12 54918436 critical splice donor site probably null
R0532:Baz1a UTSW 12 54934820 missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54941519 nonsense probably null
R0626:Baz1a UTSW 12 54975270 missense probably damaging 0.99
R0654:Baz1a UTSW 12 54911397 missense probably benign 0.01
R0782:Baz1a UTSW 12 54894488 missense probably damaging 1.00
R0826:Baz1a UTSW 12 54930312 nonsense probably null
R0855:Baz1a UTSW 12 54900563 splice site probably benign
R0927:Baz1a UTSW 12 54894988 missense probably damaging 1.00
R0941:Baz1a UTSW 12 54898431 missense probably benign 0.00
R1157:Baz1a UTSW 12 54929564 missense probably damaging 1.00
R1647:Baz1a UTSW 12 54975198 missense probably damaging 1.00
R1731:Baz1a UTSW 12 54918545 missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54898788 nonsense probably null
R1762:Baz1a UTSW 12 54909020 missense probably damaging 1.00
R1770:Baz1a UTSW 12 54898508 missense probably damaging 1.00
R1968:Baz1a UTSW 12 54900337 missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54929646 missense probably damaging 1.00
R2111:Baz1a UTSW 12 54911385 missense probably damaging 1.00
R2215:Baz1a UTSW 12 54975369 nonsense probably null
R2282:Baz1a UTSW 12 54916812 nonsense probably null
R2875:Baz1a UTSW 12 54923119 missense probably damaging 1.00
R2890:Baz1a UTSW 12 54898517 missense probably benign
R2971:Baz1a UTSW 12 54923439 missense probably damaging 1.00
R3404:Baz1a UTSW 12 54916989 missense probably benign 0.00
R3419:Baz1a UTSW 12 54946899 missense probably benign 0.05
R3699:Baz1a UTSW 12 54917046 missense probably benign 0.09
R3899:Baz1a UTSW 12 54934804 missense probably benign 0.01
R3927:Baz1a UTSW 12 54921143 missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54929619 missense probably benign 0.00
R4072:Baz1a UTSW 12 54941560 missense probably benign 0.18
R4196:Baz1a UTSW 12 54911415 missense probably damaging 1.00
R4289:Baz1a UTSW 12 54900448 missense probably damaging 1.00
R4455:Baz1a UTSW 12 54911368 missense probably benign 0.26
R4583:Baz1a UTSW 12 54922540 missense probably damaging 0.99
R4622:Baz1a UTSW 12 54941515 missense probably benign 0.00
R4807:Baz1a UTSW 12 54898482 missense probably benign 0.28
R4998:Baz1a UTSW 12 54975137 missense probably damaging 1.00
R5239:Baz1a UTSW 12 54898344 missense probably damaging 0.99
R5379:Baz1a UTSW 12 54894348 missense probably damaging 1.00
R5408:Baz1a UTSW 12 54923050 missense probably damaging 1.00
R5678:Baz1a UTSW 12 54900532 missense probably damaging 0.99
R5810:Baz1a UTSW 12 54927715 intron probably benign
R6092:Baz1a UTSW 12 54909083 missense possibly damaging 0.88
R6317:Baz1a UTSW 12 54954800 missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54918554 missense probably benign 0.01
R6803:Baz1a UTSW 12 54941555 missense probably null 0.99
R7185:Baz1a UTSW 12 54975308 missense probably damaging 1.00
R7248:Baz1a UTSW 12 54900508 missense probably damaging 1.00
R7392:Baz1a UTSW 12 54898765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAGCATTTGAGGAACCTCCTGG -3'
(R):5'- AGTAGCAGTCTTAATAGCAAGCGCC -3'

Sequencing Primer
(F):5'- TCCTGGGCTGCCAAACAG -3'
(R):5'- CTGAAGATTGCCCTGAATTCCAG -3'
Posted On2013-11-18