Incidental Mutation 'R1079:Mphosph8'
ID85799
Institutional Source Beutler Lab
Gene Symbol Mphosph8
Ensembl Gene ENSMUSG00000079184
Gene NameM-phase phosphoprotein 8
Synonyms4930548G07Rik, 1500035L22Rik
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56668248-56697430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56674259 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 246 (D246E)
Ref Sequence ENSEMBL: ENSMUSP00000112170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116468]
Predicted Effect probably damaging
Transcript: ENSMUST00000116468
AA Change: D246E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112170
Gene: ENSMUSG00000079184
AA Change: D246E

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
CHROMO 58 111 6.2e-13 SMART
low complexity region 152 160 N/A INTRINSIC
coiled coil region 226 256 N/A INTRINSIC
low complexity region 325 336 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
Blast:ANK 563 592 1e-7 BLAST
ANK 598 627 4.43e-2 SMART
ANK 631 660 5.45e-2 SMART
ANK 664 693 1.08e-5 SMART
Blast:ANK 697 726 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130246
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Mphosph8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Mphosph8 APN 14 56674443 missense probably benign 0.00
IGL00786:Mphosph8 APN 14 56672544 missense probably benign 0.00
IGL01635:Mphosph8 APN 14 56672546 missense probably damaging 0.99
IGL02104:Mphosph8 APN 14 56674579 missense probably benign 0.02
IGL02387:Mphosph8 APN 14 56695721 missense probably damaging 1.00
IGL02486:Mphosph8 APN 14 56688387 missense possibly damaging 0.80
IGL02547:Mphosph8 APN 14 56672484 missense probably damaging 1.00
IGL02578:Mphosph8 APN 14 56674210 missense probably benign
IGL03247:Mphosph8 APN 14 56678820 critical splice donor site probably null
IGL03377:Mphosph8 APN 14 56693486 missense probably damaging 1.00
R0412:Mphosph8 UTSW 14 56674413 missense probably damaging 0.97
R0647:Mphosph8 UTSW 14 56674405 missense probably benign
R1451:Mphosph8 UTSW 14 56668421 missense possibly damaging 0.62
R1486:Mphosph8 UTSW 14 56689039 missense probably damaging 1.00
R1687:Mphosph8 UTSW 14 56672478 missense probably damaging 1.00
R1733:Mphosph8 UTSW 14 56693459 missense probably damaging 1.00
R1809:Mphosph8 UTSW 14 56672452 missense probably damaging 1.00
R1844:Mphosph8 UTSW 14 56697159 missense probably damaging 1.00
R2132:Mphosph8 UTSW 14 56678704 missense probably benign 0.04
R4242:Mphosph8 UTSW 14 56674314 missense probably benign 0.00
R4261:Mphosph8 UTSW 14 56674465 missense probably benign 0.00
R4563:Mphosph8 UTSW 14 56691000 missense probably benign 0.00
R4962:Mphosph8 UTSW 14 56678589 missense probably benign 0.27
R5121:Mphosph8 UTSW 14 56676546 nonsense probably null
R6082:Mphosph8 UTSW 14 56668541 missense probably damaging 1.00
R6224:Mphosph8 UTSW 14 56668353 start codon destroyed probably null
R6455:Mphosph8 UTSW 14 56688486 missense probably damaging 1.00
R7086:Mphosph8 UTSW 14 56668523 missense possibly damaging 0.94
R7236:Mphosph8 UTSW 14 56674297 missense possibly damaging 0.63
R7266:Mphosph8 UTSW 14 56685040 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGATAGCGACCAGCAAAGTGACAC -3'
(R):5'- CTTTTCAGGGTTTGGGCAAACACAG -3'

Sequencing Primer
(F):5'- TGGAGAGCACCTCTGAAATAATC -3'
(R):5'- AAGGCATTCGTGCTTTCAAG -3'
Posted On2013-11-18