Incidental Mutation 'R1079:Nudt12'
ID85805
Institutional Source Beutler Lab
Gene Symbol Nudt12
Ensembl Gene ENSMUSG00000024228
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 12
Synonyms
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location58999618-59013372 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 59011037 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025065] [ENSMUST00000174122]
Predicted Effect probably benign
Transcript: ENSMUST00000025065
SMART Domains Protein: ENSMUSP00000025065
Gene: ENSMUSG00000024228

DomainStartEndE-ValueType
ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 3.2e-10 PFAM
Pfam:zf-NADH-PPase 279 309 2.7e-10 PFAM
Pfam:NUDIX 322 447 8.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152750
Predicted Effect probably benign
Transcript: ENSMUST00000174122
SMART Domains Protein: ENSMUSP00000133678
Gene: ENSMUSG00000024228

DomainStartEndE-ValueType
ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 2.4e-9 PFAM
Pfam:zf-NADH-PPase 279 311 5.9e-11 PFAM
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleotides are involved in numerous biochemical reactions and pathways within the cell as substrates, cofactors, and effectors. Nudix hydrolases, such as NUDT12, regulate the concentrations of individual nucleotides and of nucleotide ratios in response to changing circumstances (Abdelraheim et al., 2003 [PubMed 12790796]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Nudt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02860:Nudt12 APN 17 59010435 missense probably benign 0.01
IGL02904:Nudt12 APN 17 59010352 missense probably benign 0.00
IGL03206:Nudt12 APN 17 59007672 missense probably benign 0.00
R0121:Nudt12 UTSW 17 59007639 missense possibly damaging 0.80
R0673:Nudt12 UTSW 17 59007622 critical splice donor site probably null
R0761:Nudt12 UTSW 17 59011069 missense probably benign 0.00
R1277:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1815:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1816:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1834:Nudt12 UTSW 17 59011076 missense probably damaging 1.00
R2296:Nudt12 UTSW 17 59010049 missense possibly damaging 0.85
R2415:Nudt12 UTSW 17 59006608 missense probably damaging 0.99
R5011:Nudt12 UTSW 17 58996504 unclassified probably benign
R5384:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5385:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5874:Nudt12 UTSW 17 59010284 nonsense probably null
R6108:Nudt12 UTSW 17 59007749 missense probably damaging 1.00
R6477:Nudt12 UTSW 17 59011145 missense probably benign 0.12
R7030:Nudt12 UTSW 17 59003353 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CCTGGGCATTGTTTTCAACAAAGTACC -3'
(R):5'- TGCTGCCTTTCCAAGATCAGCATC -3'

Sequencing Primer
(F):5'- gcttacttaatccctaacactgac -3'
(R):5'- GGAGATGATTTCTGAACTCCACAG -3'
Posted On2013-11-18