Incidental Mutation 'R0714:Olfr1307'
ID85892
Institutional Source Beutler Lab
Gene Symbol Olfr1307
Ensembl Gene ENSMUSG00000094747
Gene Nameolfactory receptor 1307
SynonymsMOR245-19P, GA_x6K02T2Q125-72988111-72987173
MMRRC Submission 038897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R0714 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111930116-111949440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111944553 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 301 (V301A)
Ref Sequence ENSEMBL: ENSMUSP00000097201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099604] [ENSMUST00000099606]
Predicted Effect probably benign
Transcript: ENSMUST00000099604
AA Change: V301A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097199
Gene: ENSMUSG00000094747
AA Change: V301A

DomainStartEndE-ValueType
Pfam:7tm_4 38 311 1.5e-36 PFAM
Pfam:7tm_1 49 295 6.5e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099606
AA Change: V301A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097201
Gene: ENSMUSG00000094747
AA Change: V301A

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-42 PFAM
Pfam:7tm_1 41 287 6.7e-23 PFAM
Meta Mutation Damage Score 0.1256 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b G A 19: 21,678,609 R85H probably damaging Het
Adamts13 A G 2: 26,986,985 probably benign Het
Alb T C 5: 90,462,806 S82P possibly damaging Het
Arhgap10 G A 8: 77,351,687 probably benign Het
Aspscr1 T A 11: 120,703,667 probably null Het
Capn3 A T 2: 120,491,880 Q359L probably benign Het
Ccdc110 A T 8: 45,943,010 D646V possibly damaging Het
Ccr2 G A 9: 124,105,929 G82D probably benign Het
Col6a4 A G 9: 106,017,903 probably benign Het
Dhx29 T C 13: 112,927,965 V58A possibly damaging Het
Dhx35 C A 2: 158,844,183 Q593K probably benign Het
Dmd T C X: 84,309,897 L2240P probably benign Het
Emc7 A G 2: 112,462,932 N162S possibly damaging Het
Exoc7 A T 11: 116,293,294 N483K probably benign Het
Fbxo34 T C 14: 47,530,029 V282A probably damaging Het
Fndc3c1 A T X: 106,425,366 Y1087* probably null Het
Kat2a A G 11: 100,711,352 V192A probably damaging Het
Larp7 T C 3: 127,547,184 D64G probably damaging Het
Lnx1 A G 5: 74,607,909 probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nckipsd C A 9: 108,814,134 probably benign Het
Ndufab1 A G 7: 122,096,737 probably benign Het
Nedd4 G A 9: 72,731,446 probably benign Het
Nrsn2 G A 2: 152,374,122 R54* probably null Het
Nt5dc3 T A 10: 86,812,374 V171E probably damaging Het
Nudt8 A G 19: 4,002,023 *211W probably null Het
Nxph4 A G 10: 127,526,939 S28P probably damaging Het
Olfr1015 A G 2: 85,786,399 D296G probably damaging Het
Olfr1048 A C 2: 86,236,154 L227R probably damaging Het
Pcdhb15 A G 18: 37,474,621 Y302C probably damaging Het
Pkdrej A G 15: 85,815,511 S2075P possibly damaging Het
Sdhc A T 1: 171,129,919 probably benign Het
Sidt2 A G 9: 45,947,060 probably benign Het
Sik2 T C 9: 50,907,436 M413V probably benign Het
Slc5a4b A G 10: 76,081,507 F232L probably benign Het
Slx1b A T 7: 126,692,448 I148N probably damaging Het
Spag17 C G 3: 100,080,156 S1587R probably damaging Het
St13 T C 15: 81,383,027 D74G probably benign Het
St7l G A 3: 104,874,928 R207H probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tacc3 T C 5: 33,671,397 probably benign Het
Tbx22 G A X: 107,685,125 V421I probably benign Het
Tmc3 G A 7: 83,616,761 A705T possibly damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tonsl T C 15: 76,633,721 probably benign Het
Trpm6 T A 19: 18,838,087 I1179N possibly damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Utp23 T G 15: 51,882,269 V55G possibly damaging Het
Vps11 A G 9: 44,359,656 V143A possibly damaging Het
Vps50 G T 6: 3,571,105 V618F probably benign Het
Other mutations in Olfr1307
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01501:Olfr1307 APN 2 111944518 makesense probably null
IGL01947:Olfr1307 APN 2 111944994 missense probably benign 0.26
IGL02373:Olfr1307 APN 2 111944833 missense probably benign 0.01
IGL02682:Olfr1307 APN 2 111944940 missense probably damaging 1.00
R1670:Olfr1307 UTSW 2 111944919 missense probably damaging 1.00
R1730:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R1733:Olfr1307 UTSW 2 111945280 missense probably benign 0.13
R1773:Olfr1307 UTSW 2 111944859 missense possibly damaging 0.55
R1783:Olfr1307 UTSW 2 111945288 missense probably benign 0.45
R2180:Olfr1307 UTSW 2 111945003 missense probably benign 0.39
R2197:Olfr1307 UTSW 2 111945313 missense possibly damaging 0.64
R2207:Olfr1307 UTSW 2 111944925 missense probably damaging 1.00
R2377:Olfr1307 UTSW 2 111944643 missense probably damaging 1.00
R4425:Olfr1307 UTSW 2 111945189 missense probably benign 0.00
R4595:Olfr1307 UTSW 2 111944652 missense possibly damaging 0.86
R4859:Olfr1307 UTSW 2 111944811 missense probably damaging 0.98
R4910:Olfr1307 UTSW 2 111945078 missense possibly damaging 0.69
R5167:Olfr1307 UTSW 2 111945102 missense probably damaging 1.00
R5537:Olfr1307 UTSW 2 111945048 missense probably damaging 1.00
R6328:Olfr1307 UTSW 2 111945394 missense probably null 0.41
R6877:Olfr1307 UTSW 2 111944839 missense probably benign 0.16
R7011:Olfr1307 UTSW 2 111944686 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAAGGATTGTTCCTGCCTGAGTAGA -3'
(R):5'- CCTCGGTTTATCAAACTAGCCTGCAT -3'

Sequencing Primer
(F):5'- TGCCTGAGTAGATGAAAAAATATACC -3'
(R):5'- AGCTGGAATTCATGGTCACAGTC -3'
Posted On2013-11-18