Incidental Mutation 'R1067:Atp12a'
ID86063
Institutional Source Beutler Lab
Gene Symbol Atp12a
Ensembl Gene ENSMUSG00000022229
Gene NameATPase, H+/K+ transporting, nongastric, alpha polypeptide
SynonymscHKA, ATPase H+K+-transporting, alpha 2, Atp1al1, HKalpha2
MMRRC Submission 039153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1067 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location56365068-56388550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56373436 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 346 (G346S)
Ref Sequence ENSEMBL: ENSMUSP00000007340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007340]
Predicted Effect probably damaging
Transcript: ENSMUST00000007340
AA Change: G346S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007340
Gene: ENSMUSG00000022229
AA Change: G346S

DomainStartEndE-ValueType
low complexity region 22 36 N/A INTRINSIC
Cation_ATPase_N 54 128 9.27e-15 SMART
Pfam:E1-E2_ATPase 145 376 9.8e-57 PFAM
Pfam:Hydrolase 381 740 7.8e-20 PFAM
Pfam:HAD 384 737 7.6e-19 PFAM
Pfam:Cation_ATPase 437 532 3.4e-26 PFAM
Pfam:Cation_ATPase_C 810 1020 9.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225698
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This gene encodes a catalytic subunit of the ouabain-sensitive H+/K+ -ATPase that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for potassium absorption in various tissues. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygous mutation of this gene results in increased potassium excretion. When placed on a potassium-free diet, mutant animals display greater weight loss and slightly increased kidney weight compared to wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 A G 18: 61,823,947 probably benign Het
Adam24 T A 8: 40,680,754 C420* probably null Het
Bpifa3 A T 2: 154,137,609 Q218L probably damaging Het
Cntrl T C 2: 35,149,022 probably benign Het
Defb41 A G 1: 18,265,024 probably null Het
Edc4 C A 8: 105,891,005 T1094K probably damaging Het
Exoc4 T A 6: 33,918,424 I792N possibly damaging Het
G3bp2 A T 5: 92,063,328 probably benign Het
Herc6 T A 6: 57,662,219 N888K probably damaging Het
Iqgap1 G A 7: 80,723,828 T1471M probably benign Het
Kpna6 G T 4: 129,648,103 H500Q probably benign Het
Krt78 G A 15: 101,946,461 Q972* probably null Het
Krtap9-5 T A 11: 99,948,763 C97S unknown Het
Mapk10 T A 5: 102,991,857 probably benign Het
Mybphl A G 3: 108,365,003 T3A probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Oca2 A G 7: 56,316,393 I378V probably damaging Het
Olfr1355 T A 10: 78,879,683 C170* probably null Het
Pax6 C A 2: 105,680,301 Q2K probably benign Het
Plxna2 C A 1: 194,780,510 probably null Het
Ppp1r13b A G 12: 111,835,116 L378P probably damaging Het
Prkdc G A 16: 15,752,782 E2310K probably damaging Het
Pth2r G A 1: 65,372,348 G348E possibly damaging Het
Rarb T C 14: 16,436,769 I251V probably damaging Het
Rasa2 A G 9: 96,552,323 L637P probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Syt1 A T 10: 108,636,662 D120E probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tmbim1 A G 1: 74,290,746 probably benign Het
Tnfrsf25 G A 4: 152,118,288 C191Y probably damaging Het
Tnn T C 1: 160,125,398 K691E probably damaging Het
Trim7 T A 11: 48,837,819 V98E probably damaging Het
Tspan3 A G 9: 56,160,820 F15L probably benign Het
Uap1l1 A G 2: 25,362,747 L427S probably damaging Het
Upf1 A C 8: 70,338,403 M574R probably damaging Het
Ush2a T A 1: 188,550,207 V1931E probably benign Het
Zfp3 T C 11: 70,772,585 S457P probably damaging Het
Other mutations in Atp12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Atp12a APN 14 56379955 missense probably damaging 1.00
IGL02108:Atp12a APN 14 56384068 missense possibly damaging 0.95
IGL02176:Atp12a APN 14 56387179 missense probably damaging 1.00
IGL02210:Atp12a APN 14 56371744 nonsense probably null
IGL02828:Atp12a APN 14 56376142 missense possibly damaging 0.72
IGL02868:Atp12a APN 14 56384182 missense probably damaging 1.00
IGL02876:Atp12a APN 14 56373289 missense probably benign 0.00
R0045:Atp12a UTSW 14 56372873 missense probably damaging 1.00
R0172:Atp12a UTSW 14 56372844 missense probably damaging 1.00
R0276:Atp12a UTSW 14 56387694 missense probably damaging 1.00
R0613:Atp12a UTSW 14 56374521 missense probably damaging 1.00
R0656:Atp12a UTSW 14 56374481 missense probably damaging 1.00
R0962:Atp12a UTSW 14 56368413 missense probably damaging 1.00
R1448:Atp12a UTSW 14 56385839 missense probably damaging 1.00
R1503:Atp12a UTSW 14 56373424 missense probably damaging 1.00
R1590:Atp12a UTSW 14 56380055 missense probably damaging 1.00
R1639:Atp12a UTSW 14 56384068 missense possibly damaging 0.95
R1660:Atp12a UTSW 14 56370848 missense probably benign 0.21
R1696:Atp12a UTSW 14 56366088 missense probably damaging 1.00
R1775:Atp12a UTSW 14 56372589 missense probably benign 0.23
R1920:Atp12a UTSW 14 56386851 missense probably benign 0.19
R2022:Atp12a UTSW 14 56365282 start codon destroyed probably null
R2071:Atp12a UTSW 14 56366009 missense probably benign
R2253:Atp12a UTSW 14 56376258 missense probably benign 0.03
R2289:Atp12a UTSW 14 56373262 missense possibly damaging 0.93
R2567:Atp12a UTSW 14 56386927 missense probably damaging 1.00
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2870:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2872:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2873:Atp12a UTSW 14 56386950 missense possibly damaging 0.94
R2923:Atp12a UTSW 14 56374622 missense probably benign
R3736:Atp12a UTSW 14 56374427 missense possibly damaging 0.90
R3754:Atp12a UTSW 14 56372588 missense probably benign 0.01
R5028:Atp12a UTSW 14 56386978 missense probably damaging 0.96
R5267:Atp12a UTSW 14 56384211 missense probably damaging 1.00
R5481:Atp12a UTSW 14 56373389 missense possibly damaging 0.90
R5590:Atp12a UTSW 14 56373380 missense probably benign 0.11
R5842:Atp12a UTSW 14 56378290 missense probably damaging 0.96
R5899:Atp12a UTSW 14 56373344 missense probably benign 0.44
R5985:Atp12a UTSW 14 56384341 missense probably damaging 1.00
R6044:Atp12a UTSW 14 56376155 missense probably damaging 1.00
R6271:Atp12a UTSW 14 56378422 missense probably benign 0.00
R6454:Atp12a UTSW 14 56370833 missense probably benign 0.02
R6461:Atp12a UTSW 14 56373238 missense probably damaging 1.00
R6610:Atp12a UTSW 14 56374556 missense probably damaging 1.00
R6666:Atp12a UTSW 14 56373364 missense probably benign 0.36
R6667:Atp12a UTSW 14 56384188 missense possibly damaging 0.82
R6677:Atp12a UTSW 14 56380854 missense probably damaging 1.00
R6791:Atp12a UTSW 14 56386982 critical splice donor site probably null
R7003:Atp12a UTSW 14 56373380 missense possibly damaging 0.87
R7173:Atp12a UTSW 14 56384380 missense probably damaging 1.00
X0004:Atp12a UTSW 14 56378467 missense probably benign 0.16
Z1088:Atp12a UTSW 14 56386141 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AACTGGCATTGTCATCAACACGGG -3'
(R):5'- TTGACCAAGGACTGAGTTAGGTGGGC -3'

Sequencing Primer
(F):5'- TTGTCATCAACACGGGTGACC -3'
(R):5'- GTGAACTAACCTAGATCTCCTGAG -3'
Posted On2013-11-18