Incidental Mutation 'R1068:Kit'
ID86082
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene Namekit oncogene
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission 039154-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.877) question?
Stock #R1068 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75609518 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 197 (H197Y)
Ref Sequence ENSEMBL: ENSMUSP00000116465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: H197Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: H197Y

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143221
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: H197Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: H197Y

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,068 V25E unknown Het
4933416C03Rik C T 10: 116,113,454 V56I probably damaging Het
Acsm4 C A 7: 119,708,710 Q357K probably benign Het
Adam11 T G 11: 102,776,378 L619R probably damaging Het
Ccne2 A G 4: 11,192,850 N17S probably benign Het
Cfap52 T C 11: 67,939,004 H313R probably benign Het
Chsy3 A T 18: 59,410,289 H833L probably damaging Het
Csnk1a1 G T 18: 61,569,563 probably null Het
Cyp2c40 T C 19: 39,812,581 K77E possibly damaging Het
Dmtf1 T C 5: 9,136,109 E159G probably damaging Het
Fat3 C T 9: 15,970,034 V3181I probably benign Het
Gab1 T C 8: 80,800,172 D99G possibly damaging Het
Garem1 T C 18: 21,168,755 E125G probably benign Het
Kcnf1 A G 12: 17,175,474 Y249H probably damaging Het
Memo1 T A 17: 74,225,555 I153F probably damaging Het
Myh7 T A 14: 54,987,319 N597I possibly damaging Het
Nop2 A G 6: 125,132,279 K23E probably damaging Het
Nxf1 T A 19: 8,762,754 V95E probably damaging Het
Pamr1 T A 2: 102,642,245 C630S probably damaging Het
Ptprh G T 7: 4,549,463 P934Q possibly damaging Het
Ralgapa1 A G 12: 55,790,310 probably null Het
Ralyl T A 3: 13,776,889 N28K probably damaging Het
Rasgrp1 A G 2: 117,282,576 V785A probably benign Het
Rpp30 T A 19: 36,083,738 M1K probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snx19 G A 9: 30,429,018 R484Q probably damaging Het
Speer4a A T 5: 26,036,026 L156Q probably null Het
St18 A G 1: 6,795,562 D88G probably benign Het
Syt7 T C 19: 10,444,011 Y520H probably benign Het
Tle4 C G 19: 14,452,179 W674C probably damaging Het
Tnik T A 3: 28,532,975 Y132N probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps11 A T 9: 44,353,019 L719Q probably damaging Het
Zc3h4 T G 7: 16,429,236 H520Q unknown Het
Zdbf2 C T 1: 63,303,430 R323C possibly damaging Het
Zfp616 T A 11: 74,082,941 *99K probably null Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.02
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.96
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense probably benign 0.39
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign 0.00
IGL03381:Kit APN 5 75607128 missense probably benign 0.07
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1115:Kit UTSW 5 75649532 splice site noncoding transcript
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense possibly damaging 0.53
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCCACAGGTGTCCAATTATTCCC -3'
(R):5'- CTTTCTTTCCCAGAGCCTGAGTAGC -3'

Sequencing Primer
(F):5'- CAATTATTCCCTCATCGAGTGTG -3'
(R):5'- accttgggatgccctaaac -3'
Posted OnNov 18, 2013