Incidental Mutation 'R1068:Adam11'
ID86099
Institutional Source Beutler Lab
Gene Symbol Adam11
Ensembl Gene ENSMUSG00000020926
Gene Namea disintegrin and metallopeptidase domain 11
SynonymsMdc
MMRRC Submission 039154-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1068 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location102761439-102780262 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102776378 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 619 (L619R)
Ref Sequence ENSEMBL: ENSMUSP00000099370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068150] [ENSMUST00000103081]
Predicted Effect probably damaging
Transcript: ENSMUST00000068150
AA Change: L619R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069466
Gene: ENSMUSG00000020926
AA Change: L619R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 50 193 5.7e-29 PFAM
Pfam:Reprolysin_5 241 390 2.1e-9 PFAM
Pfam:Reprolysin 243 442 1.1e-68 PFAM
Pfam:Reprolysin_3 267 378 1.3e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103081
AA Change: L619R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099370
Gene: ENSMUSG00000020926
AA Change: L619R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 193 1.1e-28 PFAM
Pfam:Reprolysin_5 241 390 2.3e-9 PFAM
Pfam:Reprolysin 243 442 5.3e-62 PFAM
Pfam:Reprolysin_3 267 385 4.5e-9 PFAM
DISIN 457 533 3.91e-36 SMART
ACR 534 673 2.76e-56 SMART
EGF 680 714 2.32e-1 SMART
transmembrane domain 740 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142912
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143269
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. The protein encoded by this gene is believed to lack metalloproteinase activity due to the lack of a critical catalytic motif. Mice lacking the encoded protein exhibit defects in spatial learning, motor coordination and altered perception of pain. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted disruption of this gene are viable and overtly normal but show impaired hippocampus-dependent spatial learning and cerebellum-dependent motor coordination when tested using water maze and rotating rod tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,068 V25E unknown Het
4933416C03Rik C T 10: 116,113,454 V56I probably damaging Het
Acsm4 C A 7: 119,708,710 Q357K probably benign Het
Ccne2 A G 4: 11,192,850 N17S probably benign Het
Cfap52 T C 11: 67,939,004 H313R probably benign Het
Chsy3 A T 18: 59,410,289 H833L probably damaging Het
Csnk1a1 G T 18: 61,569,563 probably null Het
Cyp2c40 T C 19: 39,812,581 K77E possibly damaging Het
Dmtf1 T C 5: 9,136,109 E159G probably damaging Het
Fat3 C T 9: 15,970,034 V3181I probably benign Het
Gab1 T C 8: 80,800,172 D99G possibly damaging Het
Garem1 T C 18: 21,168,755 E125G probably benign Het
Kcnf1 A G 12: 17,175,474 Y249H probably damaging Het
Kit C T 5: 75,609,518 H197Y probably benign Het
Memo1 T A 17: 74,225,555 I153F probably damaging Het
Myh7 T A 14: 54,987,319 N597I possibly damaging Het
Nop2 A G 6: 125,132,279 K23E probably damaging Het
Nxf1 T A 19: 8,762,754 V95E probably damaging Het
Pamr1 T A 2: 102,642,245 C630S probably damaging Het
Ptprh G T 7: 4,549,463 P934Q possibly damaging Het
Ralgapa1 A G 12: 55,790,310 probably null Het
Ralyl T A 3: 13,776,889 N28K probably damaging Het
Rasgrp1 A G 2: 117,282,576 V785A probably benign Het
Rpp30 T A 19: 36,083,738 M1K probably null Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Snx19 G A 9: 30,429,018 R484Q probably damaging Het
Speer4a A T 5: 26,036,026 L156Q probably null Het
St18 A G 1: 6,795,562 D88G probably benign Het
Syt7 T C 19: 10,444,011 Y520H probably benign Het
Tle4 C G 19: 14,452,179 W674C probably damaging Het
Tnik T A 3: 28,532,975 Y132N probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps11 A T 9: 44,353,019 L719Q probably damaging Het
Zc3h4 T G 7: 16,429,236 H520Q unknown Het
Zdbf2 C T 1: 63,303,430 R323C possibly damaging Het
Zfp616 T A 11: 74,082,941 *99K probably null Het
Other mutations in Adam11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Adam11 APN 11 102776831 missense probably benign 0.40
IGL00497:Adam11 APN 11 102770147 missense probably damaging 1.00
IGL00570:Adam11 APN 11 102776350 missense possibly damaging 0.76
IGL01875:Adam11 APN 11 102772856 missense probably damaging 1.00
IGL01945:Adam11 APN 11 102772910 missense probably damaging 0.99
IGL02266:Adam11 APN 11 102772667 missense probably damaging 1.00
IGL02702:Adam11 APN 11 102777038 missense probably benign 0.26
IGL03395:Adam11 APN 11 102772920 missense probably damaging 1.00
R0091:Adam11 UTSW 11 102772839 missense probably damaging 1.00
R0135:Adam11 UTSW 11 102776573 missense probably damaging 1.00
R1529:Adam11 UTSW 11 102775113 critical splice donor site probably null
R2197:Adam11 UTSW 11 102769924 missense possibly damaging 0.94
R2357:Adam11 UTSW 11 102774508 missense probably benign
R3082:Adam11 UTSW 11 102770117 splice site probably benign
R3784:Adam11 UTSW 11 102774367 critical splice donor site probably null
R5254:Adam11 UTSW 11 102774272 nonsense probably null
R5367:Adam11 UTSW 11 102773653 missense probably benign 0.00
R5444:Adam11 UTSW 11 102772848 missense probably damaging 1.00
R5699:Adam11 UTSW 11 102773640 missense probably benign 0.00
R5881:Adam11 UTSW 11 102773810 missense probably benign 0.17
R6193:Adam11 UTSW 11 102771261 missense probably benign
R6422:Adam11 UTSW 11 102774283 missense possibly damaging 0.95
R6798:Adam11 UTSW 11 102777008 missense probably damaging 1.00
R6822:Adam11 UTSW 11 102776675 missense possibly damaging 0.68
X0023:Adam11 UTSW 11 102774630 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGTAAGCAGTAAGTAGCATCCCC -3'
(R):5'- ATAAGCAAGGCCACATCTCCGTG -3'

Sequencing Primer
(F):5'- CAGGGTCAGGGAATCTCCAG -3'
(R):5'- ATGATGGGAGCAGATCCTTCG -3'
Posted On2013-11-18