Incidental Mutation 'R1069:Ccr8'
ID 86132
Institutional Source Beutler Lab
Gene Symbol Ccr8
Ensembl Gene ENSMUSG00000042262
Gene Name C-C motif chemokine receptor 8
Synonyms Cmkbr8
MMRRC Submission 039155-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1069 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 119921199-119923972 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 119923283 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 133 (I133V)
Ref Sequence ENSEMBL: ENSMUSP00000038473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048777]
AlphaFold P56484
Predicted Effect probably benign
Transcript: ENSMUST00000048777
AA Change: I133V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038473
Gene: ENSMUSG00000042262
AA Change: I133V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 313 2.4e-8 PFAM
Pfam:7tm_1 50 298 3.3e-44 PFAM
low complexity region 338 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217495
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two independently generated knock-out alleles show normal lung eosinophilia and Th2 cytokine responses in OVA-elicited asthma models. Mice homozygous for a third knock-out allele show a delay in onset of clinical signs of experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A G 18: 6,624,037 (GRCm39) N106S probably benign Het
Akr1c21 C A 13: 4,625,333 (GRCm39) probably benign Het
Alpk2 G A 18: 65,438,085 (GRCm39) R1570C probably benign Het
Atp8b3 G A 10: 80,366,852 (GRCm39) R249C probably damaging Het
Cacnb4 C A 2: 52,345,623 (GRCm39) R252I probably damaging Het
Cars1 T C 7: 143,123,844 (GRCm39) T480A probably benign Het
Ccnf A T 17: 24,442,971 (GRCm39) C745* probably null Het
Cndp1 G A 18: 84,652,777 (GRCm39) probably benign Het
Dgkq T C 5: 108,803,903 (GRCm39) probably benign Het
Ecd A G 14: 20,383,504 (GRCm39) C312R probably damaging Het
Eddm13 A T 7: 6,258,921 (GRCm39) probably null Het
Gstm1 T C 3: 107,920,064 (GRCm39) S226G probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Hacd4 T A 4: 88,355,739 (GRCm39) I49L probably damaging Het
Hid1 T C 11: 115,247,591 (GRCm39) N269S probably damaging Het
Ifitm3 A T 7: 140,589,813 (GRCm39) probably benign Het
Kctd9 C T 14: 67,966,869 (GRCm39) probably benign Het
Kif20b T C 19: 34,928,251 (GRCm39) L1131P probably damaging Het
Kif2c T C 4: 117,035,350 (GRCm39) T33A probably damaging Het
Lipc T C 9: 70,730,819 (GRCm39) T38A probably benign Het
Lrguk A C 6: 34,025,818 (GRCm39) I205L possibly damaging Het
Mir100hg G A 9: 41,501,594 (GRCm39) R151H possibly damaging Het
Ncapg T A 5: 45,833,272 (GRCm39) probably benign Het
Ptprd A G 4: 75,916,724 (GRCm39) probably benign Het
Ptprd T A 4: 76,018,870 (GRCm39) K635* probably null Het
Sap130 G A 18: 31,844,682 (GRCm39) V898I probably damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Svep1 C T 4: 58,070,239 (GRCm39) G2516R probably damaging Het
Tas2r131 C T 6: 132,934,788 (GRCm39) R7K probably benign Het
Tfpi A G 2: 84,284,136 (GRCm39) probably benign Het
Trim80 T C 11: 115,338,909 (GRCm39) C580R probably damaging Het
Ttn T A 2: 76,800,273 (GRCm39) I312F unknown Het
Other mutations in Ccr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Ccr8 APN 9 119,923,691 (GRCm39) missense probably damaging 1.00
IGL02558:Ccr8 APN 9 119,923,724 (GRCm39) missense probably benign 0.01
IGL02966:Ccr8 APN 9 119,923,206 (GRCm39) missense probably damaging 0.96
IGL03135:Ccr8 APN 9 119,923,689 (GRCm39) missense possibly damaging 0.89
R0402:Ccr8 UTSW 9 119,923,976 (GRCm39) splice site probably null
R0739:Ccr8 UTSW 9 119,923,415 (GRCm39) missense probably damaging 1.00
R4766:Ccr8 UTSW 9 119,923,530 (GRCm39) missense probably damaging 1.00
R4934:Ccr8 UTSW 9 119,923,815 (GRCm39) missense probably benign
R5116:Ccr8 UTSW 9 119,923,095 (GRCm39) missense probably benign 0.39
R5942:Ccr8 UTSW 9 119,923,772 (GRCm39) missense probably damaging 0.99
R5957:Ccr8 UTSW 9 119,922,893 (GRCm39) missense probably damaging 0.99
R5996:Ccr8 UTSW 9 119,923,529 (GRCm39) missense probably damaging 1.00
R7223:Ccr8 UTSW 9 119,923,683 (GRCm39) missense probably damaging 0.99
R8037:Ccr8 UTSW 9 119,923,436 (GRCm39) missense probably benign
R8332:Ccr8 UTSW 9 119,923,440 (GRCm39) missense probably damaging 1.00
R8962:Ccr8 UTSW 9 119,923,613 (GRCm39) missense possibly damaging 0.56
R9344:Ccr8 UTSW 9 119,923,133 (GRCm39) missense probably damaging 1.00
Z1177:Ccr8 UTSW 9 119,923,565 (GRCm39) missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GCTGCAAGAAACTGAGGAGCATCAC -3'
(R):5'- CAGACCCAAGGCGTTGATTTCAAAG -3'

Sequencing Primer
(F):5'- GATATCTACCTCCTGAACCTGGC -3'
(R):5'- TGGGTAAAGAGCTTCCACCTC -3'
Posted On 2013-11-18