Incidental Mutation 'R1070:Actr3b'
ID86159
Institutional Source Beutler Lab
Gene Symbol Actr3b
Ensembl Gene ENSMUSG00000056367
Gene NameARP3 actin-related protein 3B
SynonymsARP11, Arp3b
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location25759997-25850688 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 25848493 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088244] [ENSMUST00000128727]
Predicted Effect probably benign
Transcript: ENSMUST00000088244
SMART Domains Protein: ENSMUSP00000085578
Gene: ENSMUSG00000056367

DomainStartEndE-ValueType
ACTIN 5 413 1.33e-178 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128727
SMART Domains Protein: ENSMUSP00000121629
Gene: ENSMUSG00000056367

DomainStartEndE-ValueType
ACTIN 1 325 1.27e-111 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the actin-related proteins (ARP), which form multiprotein complexes and share 35-55% amino acid identity with conventional actin. The protein encoded by this gene may have a regulatory role in the actin cytoskeleton and induce cell-shape change and motility. Pseudogenes of this gene are located on chromosomes 2, 4, 10, 16, 22 and Y. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr1351 C T 10: 79,017,850 P176L probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Actr3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02457:Actr3b APN 5 25849162 splice site probably null
IGL02582:Actr3b APN 5 25832413 missense probably benign 0.11
IGL02869:Actr3b APN 5 25832435 missense probably damaging 1.00
IGL02946:Actr3b APN 5 25848483 missense possibly damaging 0.50
R0443:Actr3b UTSW 5 25848411 missense probably damaging 0.99
R0446:Actr3b UTSW 5 25831732 missense probably damaging 0.98
R0727:Actr3b UTSW 5 25811939 missense possibly damaging 0.89
R1643:Actr3b UTSW 5 25812011 missense probably damaging 1.00
R1820:Actr3b UTSW 5 25849158 critical splice donor site probably null
R1837:Actr3b UTSW 5 25825159 missense probably benign 0.00
R1899:Actr3b UTSW 5 25829538 missense possibly damaging 0.71
R2041:Actr3b UTSW 5 25760130 critical splice donor site probably null
R2096:Actr3b UTSW 5 25831745 nonsense probably null
R2109:Actr3b UTSW 5 25831711 missense possibly damaging 0.89
R2256:Actr3b UTSW 5 25822405 missense possibly damaging 0.88
R3078:Actr3b UTSW 5 25822442 missense probably damaging 1.00
R5572:Actr3b UTSW 5 25809888 missense probably benign 0.00
R5655:Actr3b UTSW 5 25848368 missense probably damaging 1.00
R6190:Actr3b UTSW 5 25831690 missense probably benign
R6761:Actr3b UTSW 5 25825139 missense probably damaging 1.00
R7003:Actr3b UTSW 5 25798463 missense probably damaging 1.00
R7043:Actr3b UTSW 5 25849938 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGTAGGCAGAGACTGGACCATCAC -3'
(R):5'- TCAGACAAATCACAGGGCGTAGC -3'

Sequencing Primer
(F):5'- TGGACCATCACAGGCACTC -3'
(R):5'- TCTTGGATGAGCACGGC -3'
Posted On2013-11-18