Incidental Mutation 'R1070:Olfr1351'
ID86170
Institutional Source Beutler Lab
Gene Symbol Olfr1351
Ensembl Gene ENSMUSG00000063216
Gene Nameolfactory receptor 1351
SynonymsMOR139-4, GA_x6K02T2QGN0-2794907-2793948
MMRRC Submission 039156-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R1070 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79012472-79019645 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79017850 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 176 (P176L)
Ref Sequence ENSEMBL: ENSMUSP00000149241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080730] [ENSMUST00000203906] [ENSMUST00000216030]
Predicted Effect probably damaging
Transcript: ENSMUST00000080730
AA Change: P176L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079555
Gene: ENSMUSG00000063216
AA Change: P176L

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:7tm_4 32 308 2e-49 PFAM
Pfam:7tm_1 42 291 1.9e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203906
AA Change: P176L
SMART Domains Protein: ENSMUSP00000144814
Gene: ENSMUSG00000060205
AA Change: P176L

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:7tm_4 32 308 2e-49 PFAM
Pfam:7tm_1 42 291 1.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216030
AA Change: P176L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219714
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,543,300 D1367G probably damaging Het
Actr3b A G 5: 25,848,493 probably benign Het
Agtr1b A T 3: 20,315,748 N231K probably benign Het
AW549877 C A 15: 3,986,366 V239F probably benign Het
Bach1 T C 16: 87,720,121 S517P probably benign Het
Blzf1 A G 1: 164,303,930 probably benign Het
Bptf G T 11: 107,055,055 Q2453K possibly damaging Het
Gm853 T C 4: 130,219,156 E149G probably benign Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Heatr4 T C 12: 83,978,067 T327A possibly damaging Het
Hes1 T C 16: 30,067,283 I235T probably damaging Het
Hmcn1 T A 1: 150,689,590 D2262V probably damaging Het
Ifi208 C T 1: 173,683,044 A255V probably damaging Het
Inhbe T C 10: 127,351,513 I11M probably benign Het
Ipo9 T C 1: 135,406,543 E315G possibly damaging Het
Itih1 G T 14: 30,942,456 probably benign Het
Kcnk2 A G 1: 189,256,763 probably benign Het
Kdm4c T A 4: 74,373,628 Y827* probably null Het
Kif5a T C 10: 127,245,406 T220A probably benign Het
Krt78 A G 15: 101,946,293 Y1028H possibly damaging Het
Mylk4 T C 13: 32,724,818 D333G probably benign Het
Net1 A T 13: 3,912,930 S45T probably benign Het
Npat T A 9: 53,572,592 F1403I probably damaging Het
Olfr193 A G 16: 59,109,819 S264P probably benign Het
Olfr480 T C 7: 108,066,651 D49G probably benign Het
Pcif1 T C 2: 164,889,138 Y404H probably benign Het
Pdzd2 A G 15: 12,389,966 probably null Het
Rab3a A G 8: 70,757,194 N40S probably damaging Het
Raf1 T C 6: 115,637,699 N74D probably benign Het
Rap1gap2 A G 11: 74,437,027 V139A possibly damaging Het
Rdh12 T C 12: 79,213,748 L206P probably damaging Het
Sdhb T C 4: 140,971,236 probably benign Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Strip1 T C 3: 107,627,408 E102G possibly damaging Het
Sult2a8 T A 7: 14,413,773 I198F probably damaging Het
Tarsl2 T C 7: 65,655,696 S223P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vcam1 C T 3: 116,110,903 V732M possibly damaging Het
Vmn2r79 T C 7: 87,003,473 Y458H probably damaging Het
Other mutations in Olfr1351
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Olfr1351 APN 10 79018251 missense probably benign 0.00
IGL01833:Olfr1351 APN 10 79017936 missense probably benign
IGL02141:Olfr1351 APN 10 79017721 missense probably damaging 1.00
IGL02178:Olfr1351 APN 10 79017720 missense possibly damaging 0.59
R1631:Olfr1351 UTSW 10 79017405 missense probably benign 0.00
R1646:Olfr1351 UTSW 10 79017506 nonsense probably null
R1781:Olfr1351 UTSW 10 79017325 start codon destroyed probably null 0.89
R2358:Olfr1351 UTSW 10 79018188 missense probably damaging 1.00
R3161:Olfr1351 UTSW 10 79017604 missense probably benign
R3162:Olfr1351 UTSW 10 79017604 missense probably benign
R3162:Olfr1351 UTSW 10 79017604 missense probably benign
R5874:Olfr1351 UTSW 10 79017357 missense possibly damaging 0.95
R6382:Olfr1351 UTSW 10 79017517 missense probably damaging 1.00
R7108:Olfr1351 UTSW 10 79017649 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCCATCACCTATGCAAACTGCATC -3'
(R):5'- ACTTCCCCTGCACTGAGGAGATTG -3'

Sequencing Primer
(F):5'- CTGACTGTGATGGCCTATGACC -3'
(R):5'- TTGCACAAATGGAGGACACTATC -3'
Posted On2013-11-18