Incidental Mutation 'R1070:Hes1'
ID 86184
Institutional Source Beutler Lab
Gene Symbol Hes1
Ensembl Gene ENSMUSG00000022528
Gene Name hes family bHLH transcription factor 1
Synonyms Hry, bHLHb39
MMRRC Submission 039156-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1070 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 29883259-29886614 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29886101 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 235 (I235T)
Ref Sequence ENSEMBL: ENSMUSP00000023171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023171]
AlphaFold P35428
Predicted Effect probably damaging
Transcript: ENSMUST00000023171
AA Change: I235T

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023171
Gene: ENSMUSG00000022528
AA Change: I235T

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
HLH 40 97 6.51e-14 SMART
ORANGE 108 152 1.71e-18 SMART
low complexity region 156 204 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161839
Meta Mutation Damage Score 0.7657 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the basic helix-loop-helix family of transcription factors. It is a transcriptional repressor of genes that require a bHLH protein for their transcription. The protein has a particular type of basic domain that contains a helix interrupting protein that binds to the N-box rather than the canonical E-box. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants show anomalous timing in neurogenesis. Homozygotes for a null allele exhibit premature neurogenesis, severe neural tube defects, supernumerary hair cells in the inner ear, increased numbers of pulmonary neuroendocrine cells, and pancreatic hypoplasia. Death occurs in utero or neonatally. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(4) Gene trapped(1)
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,520,263 (GRCm39) D1367G probably damaging Het
Actr3b A G 5: 26,053,491 (GRCm39) probably benign Het
Agtr1b A T 3: 20,369,912 (GRCm39) N231K probably benign Het
Bach1 T C 16: 87,517,009 (GRCm39) S517P probably benign Het
Blzf1 A G 1: 164,131,499 (GRCm39) probably benign Het
Bptf G T 11: 106,945,881 (GRCm39) Q2453K possibly damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Heatr4 T C 12: 84,024,841 (GRCm39) T327A possibly damaging Het
Hmcn1 T A 1: 150,565,341 (GRCm39) D2262V probably damaging Het
Ifi208 C T 1: 173,510,610 (GRCm39) A255V probably damaging Het
Inhbe T C 10: 127,187,382 (GRCm39) I11M probably benign Het
Ipo9 T C 1: 135,334,281 (GRCm39) E315G possibly damaging Het
Itih1 G T 14: 30,664,413 (GRCm39) probably benign Het
Kcnk2 A G 1: 188,988,960 (GRCm39) probably benign Het
Kdm4c T A 4: 74,291,865 (GRCm39) Y827* probably null Het
Kif5a T C 10: 127,081,275 (GRCm39) T220A probably benign Het
Krt78 A G 15: 101,854,728 (GRCm39) Y1028H possibly damaging Het
Ldc1 T C 4: 130,112,949 (GRCm39) E149G probably benign Het
Mylk4 T C 13: 32,908,801 (GRCm39) D333G probably benign Het
Net1 A T 13: 3,962,930 (GRCm39) S45T probably benign Het
Npat T A 9: 53,483,892 (GRCm39) F1403I probably damaging Het
Or5h25 A G 16: 58,930,182 (GRCm39) S264P probably benign Het
Or5p57 T C 7: 107,665,858 (GRCm39) D49G probably benign Het
Or7a35 C T 10: 78,853,684 (GRCm39) P176L probably damaging Het
Pcif1 T C 2: 164,731,058 (GRCm39) Y404H probably benign Het
Pdzd2 A G 15: 12,390,052 (GRCm39) probably null Het
Rab3a A G 8: 71,209,840 (GRCm39) N40S probably damaging Het
Raf1 T C 6: 115,614,660 (GRCm39) N74D probably benign Het
Rap1gap2 A G 11: 74,327,853 (GRCm39) V139A possibly damaging Het
Rdh12 T C 12: 79,260,522 (GRCm39) L206P probably damaging Het
Rimoc1 C A 15: 4,015,848 (GRCm39) V239F probably benign Het
Sdhb T C 4: 140,698,547 (GRCm39) probably benign Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Strip1 T C 3: 107,534,724 (GRCm39) E102G possibly damaging Het
Sult2a8 T A 7: 14,147,698 (GRCm39) I198F probably damaging Het
Tars3 T C 7: 65,305,444 (GRCm39) S223P probably damaging Het
Ugt2b38 T G 5: 87,560,232 (GRCm39) N361H probably damaging Het
Vcam1 C T 3: 115,904,552 (GRCm39) V732M possibly damaging Het
Vmn2r79 T C 7: 86,652,681 (GRCm39) Y458H probably damaging Het
Other mutations in Hes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Hes1 APN 16 29,884,976 (GRCm39) splice site probably benign
IGL02010:Hes1 APN 16 29,886,128 (GRCm39) missense probably damaging 1.00
Crossing UTSW 16 29,884,997 (GRCm39) missense probably damaging 1.00
delaware UTSW 16 29,886,089 (GRCm39) missense probably damaging 1.00
I2289:Hes1 UTSW 16 29,884,699 (GRCm39) missense probably damaging 1.00
R0134:Hes1 UTSW 16 29,886,068 (GRCm39) missense probably damaging 0.98
R6385:Hes1 UTSW 16 29,884,424 (GRCm39) missense possibly damaging 0.50
R6950:Hes1 UTSW 16 29,886,089 (GRCm39) missense probably damaging 1.00
R7354:Hes1 UTSW 16 29,884,746 (GRCm39) critical splice donor site probably null
R7744:Hes1 UTSW 16 29,884,997 (GRCm39) missense probably damaging 1.00
R8237:Hes1 UTSW 16 29,886,047 (GRCm39) missense probably damaging 0.96
R8922:Hes1 UTSW 16 29,884,725 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCAGCGAGTGCATGAACGAGG -3'
(R):5'- CAAATGCAGTGCATGGTCAGTCAC -3'

Sequencing Primer
(F):5'- TGTGAGGGCGTTAACACC -3'
(R):5'- GCATGGTCAGTCACTTAATACAGC -3'
Posted On 2013-11-18