Incidental Mutation 'R1071:Apc2'
ID 86196
Institutional Source Beutler Lab
Gene Symbol Apc2
Ensembl Gene ENSMUSG00000020135
Gene Name APC regulator of WNT signaling pathway 2
Synonyms APCL
MMRRC Submission 039157-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.172) question?
Stock # R1071 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 80131811-80154097 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80147336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 768 (S768P)
Ref Sequence ENSEMBL: ENSMUSP00000020349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020349] [ENSMUST00000105359]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000020349
AA Change: S768P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135
AA Change: S768P

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105359
AA Change: S797P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135
AA Change: S797P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display gradual postnatal growth retardation, abnormal lamination of the cerebral cortex, hippocampus, olfactory bulb and cerebellum, impaired neuronal migration and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 13 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bub1b CAT C 2: 118,462,928 (GRCm39) probably null Het
Cplane1 T A 15: 8,247,910 (GRCm39) H1486Q probably benign Het
Eml4 G T 17: 83,785,468 (GRCm39) E878* probably null Het
Plcb1 A G 2: 135,167,577 (GRCm39) D457G possibly damaging Het
Prepl T C 17: 85,377,940 (GRCm39) Y480C probably damaging Het
Senp6 T A 9: 80,044,011 (GRCm39) Y708N probably benign Het
Ugt2b38 T G 5: 87,560,232 (GRCm39) N361H probably damaging Het
Ugt3a1 T C 15: 9,367,454 (GRCm39) V399A possibly damaging Het
Vmn1r30 A T 6: 58,412,813 (GRCm39) N6K possibly damaging Het
Vmn2r3 G A 3: 64,182,697 (GRCm39) T334I possibly damaging Het
Vtn C A 11: 78,392,602 (GRCm39) N393K probably benign Het
Zfp786 T C 6: 47,798,239 (GRCm39) D233G possibly damaging Het
Zmym2 A G 14: 57,197,278 (GRCm39) T1349A possibly damaging Het
Other mutations in Apc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Apc2 APN 10 80,147,820 (GRCm39) missense probably damaging 1.00
IGL01154:Apc2 APN 10 80,148,903 (GRCm39) missense possibly damaging 0.90
IGL01411:Apc2 APN 10 80,150,912 (GRCm39) missense probably damaging 0.99
IGL01598:Apc2 APN 10 80,148,882 (GRCm39) missense probably damaging 1.00
IGL01621:Apc2 APN 10 80,142,035 (GRCm39) missense probably damaging 1.00
IGL01720:Apc2 APN 10 80,150,333 (GRCm39) missense probably benign 0.01
IGL01837:Apc2 APN 10 80,150,492 (GRCm39) missense probably benign 0.24
IGL01933:Apc2 APN 10 80,147,574 (GRCm39) missense probably damaging 1.00
IGL02243:Apc2 APN 10 80,138,175 (GRCm39) missense probably damaging 1.00
IGL02292:Apc2 APN 10 80,138,258 (GRCm39) missense possibly damaging 0.59
IGL02956:Apc2 APN 10 80,142,209 (GRCm39) missense probably damaging 1.00
IGL03081:Apc2 APN 10 80,148,086 (GRCm39) missense probably damaging 1.00
IGL03172:Apc2 APN 10 80,149,220 (GRCm39) missense probably damaging 0.98
LCD18:Apc2 UTSW 10 80,135,808 (GRCm39) intron probably benign
R0278:Apc2 UTSW 10 80,148,647 (GRCm39) missense possibly damaging 0.90
R0501:Apc2 UTSW 10 80,150,958 (GRCm39) missense probably damaging 1.00
R0594:Apc2 UTSW 10 80,142,090 (GRCm39) nonsense probably null
R0607:Apc2 UTSW 10 80,149,935 (GRCm39) missense probably benign
R0624:Apc2 UTSW 10 80,150,417 (GRCm39) missense probably benign 0.00
R0633:Apc2 UTSW 10 80,143,289 (GRCm39) missense probably damaging 0.99
R0638:Apc2 UTSW 10 80,140,801 (GRCm39) missense probably damaging 0.99
R0647:Apc2 UTSW 10 80,140,762 (GRCm39) missense probably damaging 1.00
R0830:Apc2 UTSW 10 80,151,239 (GRCm39) missense probably damaging 1.00
R1221:Apc2 UTSW 10 80,142,214 (GRCm39) missense probably damaging 1.00
R1432:Apc2 UTSW 10 80,148,183 (GRCm39) missense probably benign 0.00
R1579:Apc2 UTSW 10 80,147,179 (GRCm39) missense probably damaging 1.00
R1654:Apc2 UTSW 10 80,137,676 (GRCm39) missense possibly damaging 0.75
R1700:Apc2 UTSW 10 80,148,603 (GRCm39) missense probably damaging 1.00
R1774:Apc2 UTSW 10 80,144,964 (GRCm39) missense probably damaging 1.00
R1864:Apc2 UTSW 10 80,149,482 (GRCm39) missense probably damaging 1.00
R1908:Apc2 UTSW 10 80,150,678 (GRCm39) missense probably benign 0.05
R1915:Apc2 UTSW 10 80,151,701 (GRCm39) missense probably benign
R1999:Apc2 UTSW 10 80,144,994 (GRCm39) missense probably damaging 1.00
R2050:Apc2 UTSW 10 80,143,443 (GRCm39) splice site probably null
R2219:Apc2 UTSW 10 80,144,943 (GRCm39) missense probably benign 0.41
R2393:Apc2 UTSW 10 80,148,903 (GRCm39) missense possibly damaging 0.90
R3862:Apc2 UTSW 10 80,143,393 (GRCm39) missense possibly damaging 0.82
R3900:Apc2 UTSW 10 80,131,806 (GRCm39) splice site probably null
R3901:Apc2 UTSW 10 80,150,922 (GRCm39) missense possibly damaging 0.94
R3952:Apc2 UTSW 10 80,150,318 (GRCm39) missense probably damaging 1.00
R4009:Apc2 UTSW 10 80,149,426 (GRCm39) missense probably benign 0.00
R4090:Apc2 UTSW 10 80,141,378 (GRCm39) missense probably damaging 0.97
R4695:Apc2 UTSW 10 80,146,877 (GRCm39) missense probably damaging 1.00
R4754:Apc2 UTSW 10 80,150,192 (GRCm39) missense probably benign 0.01
R4807:Apc2 UTSW 10 80,150,196 (GRCm39) missense probably benign 0.13
R4886:Apc2 UTSW 10 80,150,047 (GRCm39) missense probably damaging 1.00
R4964:Apc2 UTSW 10 80,149,841 (GRCm39) missense probably benign 0.14
R5056:Apc2 UTSW 10 80,137,148 (GRCm39) missense probably benign
R5057:Apc2 UTSW 10 80,144,903 (GRCm39) missense probably damaging 0.99
R5165:Apc2 UTSW 10 80,151,684 (GRCm39) missense probably damaging 0.99
R5241:Apc2 UTSW 10 80,148,068 (GRCm39) missense probably benign
R5649:Apc2 UTSW 10 80,149,972 (GRCm39) missense probably damaging 1.00
R5924:Apc2 UTSW 10 80,147,984 (GRCm39) missense probably damaging 1.00
R6124:Apc2 UTSW 10 80,142,185 (GRCm39) missense probably damaging 0.98
R6218:Apc2 UTSW 10 80,142,254 (GRCm39) missense probably damaging 0.98
R6376:Apc2 UTSW 10 80,148,488 (GRCm39) missense probably damaging 1.00
R6490:Apc2 UTSW 10 80,149,757 (GRCm39) missense probably benign 0.01
R6572:Apc2 UTSW 10 80,147,613 (GRCm39) missense probably damaging 1.00
R6620:Apc2 UTSW 10 80,149,401 (GRCm39) missense probably damaging 0.97
R7171:Apc2 UTSW 10 80,151,170 (GRCm39) missense possibly damaging 0.65
R7180:Apc2 UTSW 10 80,146,990 (GRCm39) missense possibly damaging 0.94
R7326:Apc2 UTSW 10 80,147,574 (GRCm39) missense probably damaging 1.00
R7340:Apc2 UTSW 10 80,149,316 (GRCm39) missense probably benign 0.12
R7378:Apc2 UTSW 10 80,147,228 (GRCm39) missense probably damaging 1.00
R7384:Apc2 UTSW 10 80,148,458 (GRCm39) missense probably damaging 1.00
R7431:Apc2 UTSW 10 80,138,017 (GRCm39) missense possibly damaging 0.83
R7543:Apc2 UTSW 10 80,150,720 (GRCm39) missense possibly damaging 0.72
R7743:Apc2 UTSW 10 80,140,749 (GRCm39) missense probably damaging 0.99
R7759:Apc2 UTSW 10 80,147,030 (GRCm39) missense probably damaging 1.00
R8244:Apc2 UTSW 10 80,151,166 (GRCm39) missense probably damaging 0.99
R8327:Apc2 UTSW 10 80,137,764 (GRCm39) missense probably damaging 1.00
R8489:Apc2 UTSW 10 80,143,298 (GRCm39) missense probably damaging 1.00
R8494:Apc2 UTSW 10 80,150,313 (GRCm39) missense probably damaging 1.00
R8669:Apc2 UTSW 10 80,149,491 (GRCm39) missense probably damaging 1.00
R8773:Apc2 UTSW 10 80,142,046 (GRCm39) missense probably damaging 1.00
R8920:Apc2 UTSW 10 80,149,934 (GRCm39) missense probably benign
R9178:Apc2 UTSW 10 80,150,235 (GRCm39) missense probably benign 0.11
R9224:Apc2 UTSW 10 80,150,111 (GRCm39) missense probably damaging 0.97
R9357:Apc2 UTSW 10 80,146,872 (GRCm39) missense probably damaging 1.00
R9394:Apc2 UTSW 10 80,145,006 (GRCm39) missense probably damaging 1.00
R9666:Apc2 UTSW 10 80,147,183 (GRCm39) missense possibly damaging 0.57
R9689:Apc2 UTSW 10 80,150,733 (GRCm39) missense probably damaging 1.00
X0018:Apc2 UTSW 10 80,148,098 (GRCm39) missense probably benign 0.02
Z1177:Apc2 UTSW 10 80,147,870 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTTTACGTCCGCAAGCAGAG -3'
(R):5'- GAGACTGAAGCTGTCGTCTGATGAG -3'

Sequencing Primer
(F):5'- GGGCTCTGGAAGCTGAGTTG -3'
(R):5'- GAGATGTCCTCCACCAATCTG -3'
Posted On 2013-11-18