Incidental Mutation 'R0106:Igsf6'
ID93734
Institutional Source Beutler Lab
Gene Symbol Igsf6
Ensembl Gene ENSMUSG00000035004
Gene Nameimmunoglobulin superfamily, member 6
Synonyms
MMRRC Submission 038392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0106 (G1)
Quality Score57
Status Validated
Chromosome7
Chromosomal Location121064067-121074572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121074454 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 18 (I18F)
Ref Sequence ENSEMBL: ENSMUSP00000039059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033163] [ENSMUST00000047194] [ENSMUST00000207351]
Predicted Effect probably benign
Transcript: ENSMUST00000033163
SMART Domains Protein: ENSMUSP00000033163
Gene: ENSMUSG00000030876

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
Pfam:DREV 56 317 1.4e-142 PFAM
Pfam:Methyltransf_23 123 289 2.7e-12 PFAM
Pfam:Methyltransf_12 150 236 9.1e-10 PFAM
Pfam:Methyltransf_11 150 238 9.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047194
AA Change: I18F

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039059
Gene: ENSMUSG00000035004
AA Change: I18F

DomainStartEndE-ValueType
IG 35 142 2.79e-2 SMART
transmembrane domain 154 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207835
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik A T 12: 112,415,194 noncoding transcript Het
Abcb9 T C 5: 124,083,060 N276S possibly damaging Het
Arhgef25 A G 10: 127,184,010 probably null Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Aspm C A 1: 139,476,876 Q1315K probably benign Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
BC055324 T C 1: 163,982,811 probably benign Het
Brf1 A G 12: 112,973,463 probably benign Het
Card19 A C 13: 49,208,145 D3E probably benign Het
Chd6 A G 2: 160,967,902 F1480L probably damaging Het
Ckap5 T C 2: 91,578,205 I915T possibly damaging Het
Ckap5 T A 2: 91,615,840 I1836N probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Cramp1l A G 17: 24,972,376 V1037A probably benign Het
Cspg5 C A 9: 110,246,532 P112Q probably damaging Het
Cyp2g1 T A 7: 26,814,182 I182N probably damaging Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Ephb6 T C 6: 41,619,594 probably benign Het
Fkbp6 C T 5: 135,340,004 R234Q probably benign Het
Gda T C 19: 21,397,556 D332G probably benign Het
Ggt7 C T 2: 155,494,893 A560T possibly damaging Het
Glis3 A T 19: 28,531,868 S239T possibly damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hsdl1 T A 8: 119,565,778 S254C probably damaging Het
Immt A G 6: 71,851,844 S128G probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kif13a G T 13: 46,825,347 probably benign Het
Kif14 T C 1: 136,479,924 probably benign Het
L2hgdh A T 12: 69,705,789 Y239* probably null Het
Lama3 T C 18: 12,403,982 V228A probably damaging Het
Lamp1 A G 8: 13,174,550 T405A probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk12 T C 15: 89,132,984 probably benign Het
Mdga2 A T 12: 66,716,706 N205K probably damaging Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nat10 A G 2: 103,757,205 V55A probably damaging Het
Nlrp10 T C 7: 108,925,322 E317G possibly damaging Het
Nomo1 T C 7: 46,037,632 I72T probably damaging Het
Olfr1450 A G 19: 12,954,356 I256V probably benign Het
Olfr974 GC G 9: 39,942,823 probably null Het
Pappa2 C T 1: 158,714,977 C1780Y probably damaging Het
Pgm2l1 A G 7: 100,250,373 M65V probably benign Het
Plec C T 15: 76,176,318 E3162K probably damaging Het
Pnisr T C 4: 21,874,617 probably benign Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Prss34 A T 17: 25,298,726 D25V probably damaging Het
Ptpn1 T C 2: 167,976,418 probably benign Het
Pygb A G 2: 150,806,203 D119G probably benign Het
Racgap1 T C 15: 99,642,958 T4A possibly damaging Het
Rap1gap2 A G 11: 74,435,744 C166R probably benign Het
Rbm28 C A 6: 29,127,803 V705L probably benign Het
Rgs1 C T 1: 144,248,549 V50M probably benign Het
Rgs12 C T 5: 34,966,664 T597I probably benign Het
Ros1 T C 10: 52,142,267 N765S possibly damaging Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scube2 A G 7: 109,846,908 probably benign Het
Serpinb10 T A 1: 107,546,744 L212Q probably damaging Het
Slc6a7 A G 18: 61,002,223 V411A probably benign Het
Slco1a6 A T 6: 142,157,390 probably benign Het
Smc1b A T 15: 85,070,819 D1077E probably damaging Het
Srek1 G A 13: 103,743,623 H476Y unknown Het
Strn3 A G 12: 51,621,788 V673A probably benign Het
Tepsin T C 11: 120,091,811 probably null Het
Timmdc1 A C 16: 38,522,362 L58R probably damaging Het
Tmem132c T C 5: 127,554,669 V664A possibly damaging Het
Tmem241 A T 18: 12,106,009 probably benign Het
Tmprss15 T C 16: 79,003,389 D602G probably damaging Het
Trbv15 T C 6: 41,141,265 probably benign Het
Wdr70 A T 15: 8,019,587 probably null Het
Other mutations in Igsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Igsf6 APN 7 121070653 nonsense probably null
IGL01592:Igsf6 APN 7 121070793 missense probably damaging 1.00
IGL02519:Igsf6 APN 7 121068273 missense possibly damaging 0.72
IGL02636:Igsf6 APN 7 121067280 intron probably benign
R0106:Igsf6 UTSW 7 121074454 missense probably benign 0.28
R1776:Igsf6 UTSW 7 121068299 missense probably damaging 0.97
R1817:Igsf6 UTSW 7 121070808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCGGTAGGAAACCTTTCTTCAG -3'
(R):5'- GCAGTTTCTAACATACACGCACGC -3'

Sequencing Primer
(F):5'- GGTAGGAAACCTTTCTTCAGCTATG -3'
(R):5'- GCACGCTTAGACTGAAATCTC -3'
Posted On2014-01-02