Incidental Mutation 'R0106:Myo1a'
ID93736
Institutional Source Beutler Lab
Gene Symbol Myo1a
Ensembl Gene ENSMUSG00000025401
Gene Namemyosin IA
Synonymsbrush border myosin 1, BBM-I, Myhl
MMRRC Submission 038392-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R0106 (G1)
Quality Score43
Status Validated
Chromosome10
Chromosomal Location127705170-127720940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127719880 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 913 (I913V)
Ref Sequence ENSEMBL: ENSMUSP00000078540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079590] [ENSMUST00000179960]
Predicted Effect probably benign
Transcript: ENSMUST00000079590
AA Change: I913V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000078540
Gene: ENSMUSG00000025401
AA Change: I913V

DomainStartEndE-ValueType
MYSc 3 695 N/A SMART
IQ 696 718 1.27e-3 SMART
IQ 719 741 1.09e-2 SMART
IQ 742 764 7.52e-6 SMART
Pfam:Myosin_TH1 847 1035 1.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179960
SMART Domains Protein: ENSMUSP00000136622
Gene: ENSMUSG00000025400

DomainStartEndE-ValueType
Pfam:Neurokinin_B 1 54 2.7e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219882
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional skeletal muscle myosin-1 (MYH1). Unconventional myosins contain the basic domains characteristic of conventional myosins and are further distinguished from class members by their tail domains. They function as actin-based molecular motors. Mutations in this gene have been associated with autosomal dominant deafness. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display abnormal small intestine brush border morphology, but have normal hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730018C14Rik A T 12: 112,415,194 noncoding transcript Het
Abcb9 T C 5: 124,083,060 N276S possibly damaging Het
Arhgef25 A G 10: 127,184,010 probably null Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Aspm C A 1: 139,476,876 Q1315K probably benign Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
BC055324 T C 1: 163,982,811 probably benign Het
Brf1 A G 12: 112,973,463 probably benign Het
Card19 A C 13: 49,208,145 D3E probably benign Het
Chd6 A G 2: 160,967,902 F1480L probably damaging Het
Ckap5 T C 2: 91,578,205 I915T possibly damaging Het
Ckap5 T A 2: 91,615,840 I1836N probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Cramp1l A G 17: 24,972,376 V1037A probably benign Het
Cspg5 C A 9: 110,246,532 P112Q probably damaging Het
Cyp2g1 T A 7: 26,814,182 I182N probably damaging Het
Dscc1 C A 15: 55,083,570 C253F probably benign Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Ephb6 T C 6: 41,619,594 probably benign Het
Fkbp6 C T 5: 135,340,004 R234Q probably benign Het
Gda T C 19: 21,397,556 D332G probably benign Het
Ggt7 C T 2: 155,494,893 A560T possibly damaging Het
Glis3 A T 19: 28,531,868 S239T possibly damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hsdl1 T A 8: 119,565,778 S254C probably damaging Het
Igsf6 T A 7: 121,074,454 I18F probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Isy1 G A 6: 87,819,185 R257W probably damaging Het
Kif13a G T 13: 46,825,347 probably benign Het
Kif14 T C 1: 136,479,924 probably benign Het
L2hgdh A T 12: 69,705,789 Y239* probably null Het
Lama3 T C 18: 12,403,982 V228A probably damaging Het
Lamp1 A G 8: 13,174,550 T405A probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk12 T C 15: 89,132,984 probably benign Het
Mdga2 A T 12: 66,716,706 N205K probably damaging Het
Nat10 A G 2: 103,757,205 V55A probably damaging Het
Nlrp10 T C 7: 108,925,322 E317G possibly damaging Het
Nomo1 T C 7: 46,037,632 I72T probably damaging Het
Olfr1450 A G 19: 12,954,356 I256V probably benign Het
Olfr974 GC G 9: 39,942,823 probably null Het
Pappa2 C T 1: 158,714,977 C1780Y probably damaging Het
Pgm2l1 A G 7: 100,250,373 M65V probably benign Het
Plec C T 15: 76,176,318 E3162K probably damaging Het
Pnisr T C 4: 21,874,617 probably benign Het
Pop7 A G 5: 137,501,649 *141Q probably null Het
Prss34 A T 17: 25,298,726 D25V probably damaging Het
Ptpn1 T C 2: 167,976,418 probably benign Het
Pygb A G 2: 150,806,203 D119G probably benign Het
Racgap1 T C 15: 99,642,958 T4A possibly damaging Het
Rap1gap2 A G 11: 74,435,744 C166R probably benign Het
Rbm28 C A 6: 29,127,803 V705L probably benign Het
Rgs1 C T 1: 144,248,549 V50M probably benign Het
Rgs12 C T 5: 34,966,664 T597I probably benign Het
Ros1 T C 10: 52,142,267 N765S possibly damaging Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scube2 A G 7: 109,846,908 probably benign Het
Serpinb10 T A 1: 107,546,744 L212Q probably damaging Het
Slc6a7 A G 18: 61,002,223 V411A probably benign Het
Slco1a6 A T 6: 142,157,390 probably benign Het
Smc1b A T 15: 85,070,819 D1077E probably damaging Het
Srek1 G A 13: 103,743,623 H476Y unknown Het
Strn3 A G 12: 51,621,788 V673A probably benign Het
Tepsin T C 11: 120,091,811 probably null Het
Timmdc1 A C 16: 38,522,362 L58R probably damaging Het
Tmem132c T C 5: 127,554,669 V664A possibly damaging Het
Tmem241 A T 18: 12,106,009 probably benign Het
Tmprss15 T C 16: 79,003,389 D602G probably damaging Het
Trbv15 T C 6: 41,141,265 probably benign Het
Wdr70 A T 15: 8,019,587 probably null Het
Other mutations in Myo1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Myo1a APN 10 127720660 missense probably benign 0.00
IGL01896:Myo1a APN 10 127719904 missense probably benign
IGL02073:Myo1a APN 10 127710225 missense probably damaging 0.98
IGL02380:Myo1a APN 10 127714485 missense probably benign 0.00
IGL02507:Myo1a APN 10 127712609 missense probably damaging 0.98
R0326:Myo1a UTSW 10 127716297 missense probably benign 0.00
R0357:Myo1a UTSW 10 127710902 missense probably benign 0.02
R0485:Myo1a UTSW 10 127719242 splice site probably benign
R0676:Myo1a UTSW 10 127719880 missense probably benign 0.02
R0707:Myo1a UTSW 10 127719863 unclassified probably benign
R1241:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1441:Myo1a UTSW 10 127719279 missense probably benign 0.00
R1458:Myo1a UTSW 10 127719937 missense probably benign
R1546:Myo1a UTSW 10 127712624 missense probably damaging 1.00
R1692:Myo1a UTSW 10 127719334 synonymous probably null
R1871:Myo1a UTSW 10 127719671 missense probably benign
R2067:Myo1a UTSW 10 127705478 missense probably benign 0.25
R2079:Myo1a UTSW 10 127720613 missense probably benign 0.00
R2151:Myo1a UTSW 10 127720181 missense probably benign 0.18
R2375:Myo1a UTSW 10 127705290 missense probably damaging 1.00
R3014:Myo1a UTSW 10 127716345 missense probably damaging 1.00
R3741:Myo1a UTSW 10 127714898 missense probably benign 0.19
R3812:Myo1a UTSW 10 127707415 missense possibly damaging 0.89
R4303:Myo1a UTSW 10 127713733 missense probably benign 0.10
R4306:Myo1a UTSW 10 127714081 missense probably benign
R4472:Myo1a UTSW 10 127710458 missense probably benign 0.06
R4599:Myo1a UTSW 10 127720151 unclassified probably null
R4604:Myo1a UTSW 10 127711138 missense probably damaging 1.00
R4649:Myo1a UTSW 10 127710217 missense probably benign 0.05
R4747:Myo1a UTSW 10 127714438 missense probably damaging 1.00
R4755:Myo1a UTSW 10 127715688 missense probably damaging 1.00
R4972:Myo1a UTSW 10 127716309 missense probably benign 0.31
R5072:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5073:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5074:Myo1a UTSW 10 127707419 critical splice donor site probably null
R5386:Myo1a UTSW 10 127705897 nonsense probably null
R5592:Myo1a UTSW 10 127714039 missense probably damaging 1.00
R5619:Myo1a UTSW 10 127718544 missense probably benign 0.00
R6001:Myo1a UTSW 10 127706925 critical splice donor site probably null
R6374:Myo1a UTSW 10 127707680 missense probably damaging 1.00
R6577:Myo1a UTSW 10 127715320 missense possibly damaging 0.94
R6932:Myo1a UTSW 10 127710458 missense probably benign 0.06
R7310:Myo1a UTSW 10 127705828 missense probably damaging 0.98
X0067:Myo1a UTSW 10 127713745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTACATCGGGCTGCAAGGG -3'
(R):5'- AGTTCAACCACATGGTCGCTCAC -3'

Sequencing Primer
(F):5'- AGGGAACCCCAAGCTGC -3'
(R):5'- AGACTGCCGATGACATCTTAG -3'
Posted On2014-01-02