Incidental Mutation 'R1037:Swt1'
ID93832
Institutional Source Beutler Lab
Gene Symbol Swt1
Ensembl Gene ENSMUSG00000052748
Gene NameSWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R1037 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location151367699-151428455 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 151370569 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000111883]
Predicted Effect probably benign
Transcript: ENSMUST00000064771
SMART Domains Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
low complexity region 783 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111883
SMART Domains Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124880
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Swt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Swt1 APN 1 151411139 missense probably damaging 0.99
IGL01622:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01623:Swt1 APN 1 151411009 missense probably benign 0.01
IGL01672:Swt1 APN 1 151394608 critical splice donor site probably null
IGL01693:Swt1 APN 1 151422104 missense probably benign 0.02
IGL02203:Swt1 APN 1 151370626 missense probably benign 0.01
IGL03223:Swt1 APN 1 151379419 missense possibly damaging 0.80
R0124:Swt1 UTSW 1 151391529 missense probably damaging 1.00
R0496:Swt1 UTSW 1 151411270 missense probably benign
R1171:Swt1 UTSW 1 151405521 missense probably damaging 1.00
R1270:Swt1 UTSW 1 151384391 missense probably benign 0.00
R1883:Swt1 UTSW 1 151423533 nonsense probably null
R2051:Swt1 UTSW 1 151372330 missense probably damaging 1.00
R2110:Swt1 UTSW 1 151403885 missense probably damaging 0.97
R2185:Swt1 UTSW 1 151384468 missense probably damaging 1.00
R3688:Swt1 UTSW 1 151391489 missense probably damaging 0.99
R3785:Swt1 UTSW 1 151379404 missense probably benign 0.03
R4074:Swt1 UTSW 1 151394769 missense probably benign
R4157:Swt1 UTSW 1 151403044 missense probably damaging 1.00
R4660:Swt1 UTSW 1 151407597 missense probably benign 0.18
R4761:Swt1 UTSW 1 151401102 missense probably benign 0.43
R4972:Swt1 UTSW 1 151423542 missense probably benign 0.22
R5141:Swt1 UTSW 1 151411394 missense probably benign 0.04
R5227:Swt1 UTSW 1 151402976 nonsense probably null
R5400:Swt1 UTSW 1 151412834 missense probably benign 0.00
R5580:Swt1 UTSW 1 151384455 missense probably benign 0.00
R5912:Swt1 UTSW 1 151411409 missense probably damaging 1.00
R5945:Swt1 UTSW 1 151411170 missense probably benign 0.01
R5973:Swt1 UTSW 1 151402949 splice site probably null
R5979:Swt1 UTSW 1 151407588 missense possibly damaging 0.94
R6242:Swt1 UTSW 1 151407614 missense probably benign 0.41
R6283:Swt1 UTSW 1 151384333 missense possibly damaging 0.78
R6951:Swt1 UTSW 1 151397268 missense possibly damaging 0.88
R7009:Swt1 UTSW 1 151370630 missense possibly damaging 0.94
R7165:Swt1 UTSW 1 151388677 missense probably damaging 1.00
R7214:Swt1 UTSW 1 151394613 missense possibly damaging 0.63
R7403:Swt1 UTSW 1 151388693 missense probably benign 0.01
R7439:Swt1 UTSW 1 151411064 missense probably benign 0.04
R7441:Swt1 UTSW 1 151411064 missense probably benign 0.04
X0062:Swt1 UTSW 1 151411439 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- AGCTGATAAACTAACAGGCTTTCTGCAT -3'
(R):5'- CAGTCACTGAACTTCTTCCTGTCATTGA -3'

Sequencing Primer
(F):5'- aggaggtggagacaggaag -3'
(R):5'- TGCCTGGAGAGCTGAAATTC -3'
Posted On2014-01-05