Incidental Mutation 'R1037:Exosc8'
ID93850
Institutional Source Beutler Lab
Gene Symbol Exosc8
Ensembl Gene ENSMUSG00000027752
Gene Nameexosome component 8
Synonyms
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1037 (G1)
Quality Score170
Status Validated
Chromosome3
Chromosomal Location54728678-54735393 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54732738 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 55 (A55E)
Ref Sequence ENSEMBL: ENSMUSP00000115876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029315] [ENSMUST00000029316] [ENSMUST00000044567] [ENSMUST00000141191] [ENSMUST00000153224] [ENSMUST00000154787] [ENSMUST00000155273] [ENSMUST00000197502] [ENSMUST00000199674] [ENSMUST00000200439] [ENSMUST00000200441]
Predicted Effect probably benign
Transcript: ENSMUST00000029315
SMART Domains Protein: ENSMUSP00000029315
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 107 159 N/A INTRINSIC
coiled coil region 201 230 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000029316
AA Change: A67E

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029316
Gene: ENSMUSG00000027752
AA Change: A67E

DomainStartEndE-ValueType
Pfam:RNase_PH 31 166 2.3e-29 PFAM
Pfam:RNase_PH_C 191 258 8.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044567
SMART Domains Protein: ENSMUSP00000035879
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 63 174 2.1e-10 PFAM
Pfam:Glycos_transf_2 68 250 2.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140935
Predicted Effect probably benign
Transcript: ENSMUST00000141191
SMART Domains Protein: ENSMUSP00000118818
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150923
Predicted Effect probably damaging
Transcript: ENSMUST00000153224
AA Change: A67E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118780
Gene: ENSMUSG00000027752
AA Change: A67E

DomainStartEndE-ValueType
Pfam:RNase_PH 31 130 2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154787
AA Change: A55E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115876
Gene: ENSMUSG00000027752
AA Change: A55E

DomainStartEndE-ValueType
Pfam:RNase_PH 19 106 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155273
SMART Domains Protein: ENSMUSP00000119260
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197502
SMART Domains Protein: ENSMUSP00000143750
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 62 227 1.9e-43 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 512 532 N/A INTRINSIC
low complexity region 574 587 N/A INTRINSIC
low complexity region 632 680 N/A INTRINSIC
coiled coil region 722 751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198780
Predicted Effect probably benign
Transcript: ENSMUST00000199674
SMART Domains Protein: ENSMUSP00000142948
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 3.3e-39 PFAM
low complexity region 424 442 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200439
SMART Domains Protein: ENSMUSP00000143059
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 45 56 N/A INTRINSIC
Pfam:Spt20 59 227 2.7e-42 PFAM
low complexity region 424 440 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 487 501 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200441
SMART Domains Protein: ENSMUSP00000143231
Gene: ENSMUSG00000027751

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 123 171 N/A INTRINSIC
coiled coil region 213 242 N/A INTRINSIC
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 3'-5' exoribonuclease that specifically interacts with mRNAs containing AU-rich elements. The encoded protein is part of the exosome complex that is important for the degradation of numerous RNA species. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Exosc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Exosc8 APN 3 54729265 missense probably damaging 0.97
IGL03348:Exosc8 APN 3 54732722 missense possibly damaging 0.91
R1233:Exosc8 UTSW 3 54731998 missense probably benign 0.30
R1623:Exosc8 UTSW 3 54734331 missense probably damaging 0.99
R1647:Exosc8 UTSW 3 54734101 critical splice donor site probably null
R1928:Exosc8 UTSW 3 54728845 missense probably damaging 1.00
R3005:Exosc8 UTSW 3 54732147 synonymous probably null
R4851:Exosc8 UTSW 3 54732102 unclassified probably benign
R4932:Exosc8 UTSW 3 54729290 missense possibly damaging 0.81
R5010:Exosc8 UTSW 3 54729223 missense probably benign 0.00
R5506:Exosc8 UTSW 3 54731179 unclassified probably benign
R5860:Exosc8 UTSW 3 54735042 unclassified probably benign
R6887:Exosc8 UTSW 3 54733699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGTTGGCAAACTGAAGTTCTTGG -3'
(R):5'- CTGCTGAACAAGTCATAGGGTGGG -3'

Sequencing Primer
(F):5'- CCGTTATCTTCTGATAAGCAGAAAGC -3'
(R):5'- AGCACAGTTTGATTACACTGCC -3'
Posted On2014-01-05