Incidental Mutation 'R1037:Pzp'
ID93863
Institutional Source Beutler Lab
Gene Symbol Pzp
Ensembl Gene ENSMUSG00000030359
Gene NamePZP, alpha-2-macroglobulin like
Synonyms
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1037 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128483567-128526720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128519426 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 281 (N281S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112132] [ENSMUST00000143664]
Predicted Effect probably benign
Transcript: ENSMUST00000032510
AA Change: N281S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000032510
Gene: ENSMUSG00000030359
AA Change: N281S

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 8.8e-22 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1002 5.7e-19 PFAM
Pfam:A2M_comp 1022 1284 1.6e-93 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112132
AA Change: N281S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000107760
Gene: ENSMUSG00000030359
AA Change: N281S

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 219 3.2e-23 PFAM
low complexity region 327 338 N/A INTRINSIC
A2M_N_2 458 606 6.18e-40 SMART
A2M 750 840 2.27e-38 SMART
Pfam:Thiol-ester_cl 973 1003 4e-19 PFAM
Pfam:A2M_comp 1022 1284 2.1e-90 PFAM
A2M_recep 1395 1482 6.47e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143664
SMART Domains Protein: ENSMUSP00000120114
Gene: ENSMUSG00000030359

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
Pfam:A2M_N 126 212 4.8e-21 PFAM
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Homozygotes mutant null mice show higher bone mineral density, hypoactivity, and decreased heart rate. Mice homozygous for a different null allele show resistance to the lethal effects of endotoxin, increased susceptibility to diet-induced acute pancreatitis, and altered LPS-induced febrile and cytokine responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Pzp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Pzp APN 6 128516909 missense probably benign 0.25
IGL01470:Pzp APN 6 128521124 missense probably benign 0.05
IGL01753:Pzp APN 6 128502183 missense possibly damaging 0.78
IGL01878:Pzp APN 6 128495298 missense probably damaging 1.00
IGL02307:Pzp APN 6 128489086 nonsense probably null
IGL02338:Pzp APN 6 128486170 missense probably benign 0.07
IGL02546:Pzp APN 6 128494699 splice site probably benign
IGL02598:Pzp APN 6 128487457 missense probably benign 0.00
IGL02699:Pzp APN 6 128487401 critical splice donor site probably null
P4748:Pzp UTSW 6 128490089 missense probably damaging 1.00
PIT4151001:Pzp UTSW 6 128525296 missense probably benign 0.34
PIT4495001:Pzp UTSW 6 128502229 missense probably benign
R0157:Pzp UTSW 6 128523976 nonsense probably null
R0195:Pzp UTSW 6 128487478 missense probably damaging 1.00
R0238:Pzp UTSW 6 128489156 splice site probably benign
R0239:Pzp UTSW 6 128489156 splice site probably benign
R0271:Pzp UTSW 6 128519514 missense probably damaging 1.00
R0299:Pzp UTSW 6 128495330 splice site probably benign
R0744:Pzp UTSW 6 128516195 unclassified probably benign
R0968:Pzp UTSW 6 128525145 missense probably benign 0.00
R1074:Pzp UTSW 6 128487924 missense probably benign 0.20
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1469:Pzp UTSW 6 128512356 missense probably benign 0.04
R1579:Pzp UTSW 6 128523968 critical splice donor site probably null
R1646:Pzp UTSW 6 128503555 missense probably benign 0.33
R1770:Pzp UTSW 6 128485617 missense probably damaging 1.00
R1777:Pzp UTSW 6 128490572 missense possibly damaging 0.85
R1786:Pzp UTSW 6 128491161 splice site probably null
R1854:Pzp UTSW 6 128502225 missense probably damaging 1.00
R2001:Pzp UTSW 6 128516120 missense probably benign 0.01
R2060:Pzp UTSW 6 128483710 missense probably benign 0.45
R2081:Pzp UTSW 6 128519420 missense probably benign 0.00
R2130:Pzp UTSW 6 128491161 splice site probably null
R2131:Pzp UTSW 6 128491161 splice site probably null
R2160:Pzp UTSW 6 128525276 missense probably damaging 1.00
R2168:Pzp UTSW 6 128488047 missense probably damaging 0.98
R2328:Pzp UTSW 6 128510390 missense possibly damaging 0.79
R2441:Pzp UTSW 6 128489768 nonsense probably null
R2866:Pzp UTSW 6 128525264 missense possibly damaging 0.76
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2869:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2870:Pzp UTSW 6 128485556 critical splice donor site probably null
R2873:Pzp UTSW 6 128485556 critical splice donor site probably null
R2876:Pzp UTSW 6 128491550 missense probably damaging 1.00
R3404:Pzp UTSW 6 128513806 missense probably damaging 1.00
R4452:Pzp UTSW 6 128491240 missense probably damaging 1.00
R4461:Pzp UTSW 6 128524040 missense probably benign 0.02
R5103:Pzp UTSW 6 128502229 missense probably benign 0.04
R5193:Pzp UTSW 6 128502334 missense probably benign 0.00
R5425:Pzp UTSW 6 128489048 missense probably damaging 0.97
R5465:Pzp UTSW 6 128486961 missense probably damaging 1.00
R5590:Pzp UTSW 6 128523796 missense probably damaging 1.00
R5656:Pzp UTSW 6 128490072 missense probably damaging 0.99
R5697:Pzp UTSW 6 128525189 missense probably benign 0.03
R5854:Pzp UTSW 6 128506869 missense probably benign 0.01
R5994:Pzp UTSW 6 128491597 missense probably damaging 1.00
R6042:Pzp UTSW 6 128524014 missense possibly damaging 0.75
R6054:Pzp UTSW 6 128513764 missense probably benign 0.03
R6153:Pzp UTSW 6 128489016 missense probably benign
R6465:Pzp UTSW 6 128491619 missense probably damaging 1.00
R6719:Pzp UTSW 6 128524083 missense probably benign 0.17
R6722:Pzp UTSW 6 128487954 missense probably damaging 1.00
R7316:Pzp UTSW 6 128513773 missense probably damaging 0.99
R7453:Pzp UTSW 6 128486916 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCTCATTCAGCCCACATCAGC -3'
(R):5'- GGTCCAGTCAGGGAAAGAAACCATC -3'

Sequencing Primer
(F):5'- gcagttatagattcataatctctgcc -3'
(R):5'- ATCCGTGACACTCACATTCG -3'
Posted On2014-01-05