Incidental Mutation 'R1037:Tenm4'
ID93865
Institutional Source Beutler Lab
Gene Symbol Tenm4
Ensembl Gene ENSMUSG00000048078
Gene Nameteneurin transmembrane protein 4
SynonymsDoc4, l7Rn3, Ten-m4, ELM2, l(7)-3Rn, Odz4
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1037 (G1)
Quality Score183
Status Validated
Chromosome7
Chromosomal Location96171246-96911093 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96797481 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 853 (W853R)
Ref Sequence ENSEMBL: ENSMUSP00000102780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107162] [ENSMUST00000107165] [ENSMUST00000107166]
Predicted Effect probably damaging
Transcript: ENSMUST00000107162
AA Change: W853R

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102780
Gene: ENSMUSG00000048078
AA Change: W853R

DomainStartEndE-ValueType
Pfam:Ten_N 10 410 5.6e-195 PFAM
transmembrane domain 411 433 N/A INTRINSIC
EGF_like 637 665 3.43e1 SMART
EGF 668 696 2.29e1 SMART
EGF 701 730 1.88e-1 SMART
EGF 733 762 1.13e1 SMART
EGF 767 797 2.39e1 SMART
EGF 800 828 4.32e-1 SMART
EGF 831 859 6.02e0 SMART
EGF 862 894 9.93e-1 SMART
low complexity region 900 914 N/A INTRINSIC
Pfam:RHS_repeat 2327 2380 5.5e-7 PFAM
Pfam:Tox-GHH 2740 2818 5.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107165
AA Change: W845R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102783
Gene: ENSMUSG00000048078
AA Change: W845R

DomainStartEndE-ValueType
Pfam:Ten_N 36 402 1.1e-171 PFAM
transmembrane domain 403 425 N/A INTRINSIC
EGF_like 629 657 3.43e1 SMART
EGF 660 688 2.29e1 SMART
EGF 693 722 1.88e-1 SMART
EGF 725 754 1.13e1 SMART
EGF 759 789 2.39e1 SMART
EGF 792 820 4.32e-1 SMART
EGF 823 851 6.02e0 SMART
EGF 863 895 9.93e-1 SMART
low complexity region 901 915 N/A INTRINSIC
Pfam:RHS_repeat 2335 2368 1.6e-7 PFAM
Pfam:Tox-GHH 2749 2826 1.8e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107166
AA Change: W808R

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102784
Gene: ENSMUSG00000048078
AA Change: W808R

DomainStartEndE-ValueType
Pfam:Ten_N 35 193 1.4e-83 PFAM
Pfam:Ten_N 187 365 5e-78 PFAM
transmembrane domain 366 388 N/A INTRINSIC
EGF_like 592 620 3.43e1 SMART
EGF 623 651 2.29e1 SMART
EGF 656 685 1.88e-1 SMART
EGF 688 717 1.13e1 SMART
EGF 722 752 2.39e1 SMART
EGF 755 783 4.32e-1 SMART
EGF 786 814 6.02e0 SMART
EGF 826 858 9.93e-1 SMART
low complexity region 864 878 N/A INTRINSIC
Pfam:RHS_repeat 2298 2351 3.8e-7 PFAM
Pfam:Tox-GHH 2711 2789 3.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130299
Predicted Effect unknown
Transcript: ENSMUST00000140140
AA Change: W83R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155101
Meta Mutation Damage Score 0.694 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene plays a role in establishing proper neuronal connectivity during development. Defects in this gene have been associated with hereditary essential tremor-5. [provided by RefSeq, Oct 2016]
PHENOTYPE: Various ENU-induced alleles cause prenatal lethality associated with impaired mesoderm development and lead to pleiotropic phenotypes. The most severe alleles cause failure of gastrulation and somitogenesis while the least severe one allows survival to adulthood with runting of variable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Tenm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Tenm4 APN 7 96868009 missense probably benign 0.00
IGL00468:Tenm4 APN 7 96874472 missense probably damaging 0.98
IGL00519:Tenm4 APN 7 96805138 splice site probably benign
IGL00979:Tenm4 APN 7 96729391 missense probably damaging 0.96
IGL01401:Tenm4 APN 7 96874267 missense probably damaging 1.00
IGL01459:Tenm4 APN 7 96729385 missense probably damaging 1.00
IGL01519:Tenm4 APN 7 96895177 missense probably damaging 1.00
IGL01545:Tenm4 APN 7 96874303 missense probably benign 0.00
IGL01579:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01587:Tenm4 APN 7 96863502 missense probably benign 0.00
IGL01625:Tenm4 APN 7 96885358 missense probably damaging 1.00
IGL01655:Tenm4 APN 7 96553724 missense probably damaging 1.00
IGL01683:Tenm4 APN 7 96885404 missense possibly damaging 0.84
IGL01728:Tenm4 APN 7 96896064 missense probably damaging 1.00
IGL01732:Tenm4 APN 7 96895509 missense probably damaging 1.00
IGL01924:Tenm4 APN 7 96895212 missense probably damaging 1.00
IGL01966:Tenm4 APN 7 96553550 missense probably damaging 1.00
IGL02177:Tenm4 APN 7 96895662 missense probably benign 0.40
IGL02207:Tenm4 APN 7 96874116 missense possibly damaging 0.85
IGL02269:Tenm4 APN 7 96823822 missense probably damaging 1.00
IGL02274:Tenm4 APN 7 96854734 missense probably damaging 1.00
IGL02375:Tenm4 APN 7 96704137 missense possibly damaging 0.52
IGL02415:Tenm4 APN 7 96874074 missense probably damaging 0.98
IGL02472:Tenm4 APN 7 96774176 unclassified probably benign
IGL02656:Tenm4 APN 7 96885433 missense probably damaging 1.00
IGL02678:Tenm4 APN 7 96896219 missense probably damaging 1.00
IGL02829:Tenm4 APN 7 96894998 nonsense probably null
IGL02863:Tenm4 APN 7 96873706 missense probably damaging 1.00
IGL03145:Tenm4 APN 7 96842968 missense probably damaging 0.98
IGL03153:Tenm4 APN 7 96873762 missense probably damaging 1.00
principium UTSW 7 96797481 missense probably damaging 0.98
toccata UTSW 7 96902989 critical splice donor site probably null
P0026:Tenm4 UTSW 7 96874527 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0097:Tenm4 UTSW 7 96892926 missense probably damaging 1.00
R0140:Tenm4 UTSW 7 96896052 missense possibly damaging 0.78
R0164:Tenm4 UTSW 7 96729340 splice site probably benign
R0277:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0323:Tenm4 UTSW 7 96694950 missense possibly damaging 0.54
R0362:Tenm4 UTSW 7 96772035 nonsense probably null
R0381:Tenm4 UTSW 7 96905881 missense probably damaging 1.00
R0420:Tenm4 UTSW 7 96873766 missense possibly damaging 0.85
R0426:Tenm4 UTSW 7 96777851 missense probably damaging 1.00
R0513:Tenm4 UTSW 7 96895623 missense probably benign 0.35
R0624:Tenm4 UTSW 7 96774020 missense probably damaging 1.00
R0837:Tenm4 UTSW 7 96896275 splice site probably benign
R1172:Tenm4 UTSW 7 96848044 missense probably damaging 1.00
R1422:Tenm4 UTSW 7 96550051 missense probably damaging 0.99
R1427:Tenm4 UTSW 7 96843048 missense probably benign 0.42
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1462:Tenm4 UTSW 7 96704153 missense probably damaging 1.00
R1597:Tenm4 UTSW 7 96902989 critical splice donor site probably null
R1701:Tenm4 UTSW 7 96902889 missense probably damaging 1.00
R1707:Tenm4 UTSW 7 96888685 missense probably damaging 1.00
R1809:Tenm4 UTSW 7 96873780 missense probably benign 0.17
R1812:Tenm4 UTSW 7 96895940 missense probably damaging 1.00
R1895:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R1933:Tenm4 UTSW 7 96895326 missense probably damaging 1.00
R1946:Tenm4 UTSW 7 96735808 missense probably damaging 1.00
R2108:Tenm4 UTSW 7 96906290 missense probably damaging 1.00
R2151:Tenm4 UTSW 7 96902847 missense probably damaging 1.00
R2247:Tenm4 UTSW 7 96906009 missense probably benign 0.03
R2329:Tenm4 UTSW 7 96895862 missense probably benign 0.00
R2893:Tenm4 UTSW 7 96894990 missense probably damaging 1.00
R2990:Tenm4 UTSW 7 96893125 synonymous probably null
R3409:Tenm4 UTSW 7 96895160 missense probably damaging 1.00
R3410:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3411:Tenm4 UTSW 7 96852530 missense probably damaging 0.99
R3440:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3441:Tenm4 UTSW 7 96553516 missense probably benign 0.00
R3719:Tenm4 UTSW 7 96863563 missense possibly damaging 0.92
R3772:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R3773:Tenm4 UTSW 7 96694880 missense probably damaging 1.00
R4093:Tenm4 UTSW 7 96895772 missense probably damaging 1.00
R4439:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4441:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4510:Tenm4 UTSW 7 96894863 missense probably benign
R4511:Tenm4 UTSW 7 96894863 missense probably benign
R4543:Tenm4 UTSW 7 96895815 missense probably benign 0.01
R4645:Tenm4 UTSW 7 96895742 missense probably damaging 1.00
R4701:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R4707:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4714:Tenm4 UTSW 7 96894924 missense probably damaging 1.00
R4742:Tenm4 UTSW 7 96797484 missense probably damaging 0.99
R4784:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4785:Tenm4 UTSW 7 96774046 missense probably damaging 0.99
R4801:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4802:Tenm4 UTSW 7 96906245 missense probably damaging 0.97
R4880:Tenm4 UTSW 7 96905818 splice site probably null
R5036:Tenm4 UTSW 7 96694790 missense probably damaging 1.00
R5036:Tenm4 UTSW 7 96852561 missense probably damaging 1.00
R5050:Tenm4 UTSW 7 96895788 missense probably damaging 1.00
R5103:Tenm4 UTSW 7 96842957 missense probably damaging 1.00
R5106:Tenm4 UTSW 7 96843149 missense probably damaging 0.99
R5118:Tenm4 UTSW 7 96893086 missense probably damaging 1.00
R5272:Tenm4 UTSW 7 96874203 missense probably damaging 0.98
R5282:Tenm4 UTSW 7 96837331 missense possibly damaging 0.90
R5403:Tenm4 UTSW 7 96888827 missense probably damaging 1.00
R5404:Tenm4 UTSW 7 96894680 missense probably damaging 1.00
R5567:Tenm4 UTSW 7 96896209 nonsense probably null
R5590:Tenm4 UTSW 7 96797400 missense possibly damaging 0.73
R5590:Tenm4 UTSW 7 96797401 missense possibly damaging 0.93
R5597:Tenm4 UTSW 7 96553517 missense probably benign 0.00
R5782:Tenm4 UTSW 7 96893039 missense probably benign 0.00
R5861:Tenm4 UTSW 7 96843217 intron probably benign
R5890:Tenm4 UTSW 7 96902860 missense probably damaging 1.00
R5930:Tenm4 UTSW 7 96854719 missense probably damaging 1.00
R5940:Tenm4 UTSW 7 96845895 missense probably damaging 1.00
R6012:Tenm4 UTSW 7 96522433 intron probably benign
R6060:Tenm4 UTSW 7 96873711 missense probably damaging 1.00
R6104:Tenm4 UTSW 7 96837289 missense probably damaging 0.97
R6283:Tenm4 UTSW 7 96874494 missense probably benign 0.33
R6333:Tenm4 UTSW 7 96774124 missense probably damaging 1.00
R6522:Tenm4 UTSW 7 96843044 missense possibly damaging 0.88
R6616:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6746:Tenm4 UTSW 7 96892860 missense probably damaging 1.00
R6751:Tenm4 UTSW 7 96845712 missense possibly damaging 0.95
R6806:Tenm4 UTSW 7 96811959 missense possibly damaging 0.95
R6807:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6807:Tenm4 UTSW 7 96895271 missense probably damaging 1.00
R6809:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6810:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6811:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6853:Tenm4 UTSW 7 96837295 missense possibly damaging 0.94
R6886:Tenm4 UTSW 7 96797392 missense possibly damaging 0.85
R6920:Tenm4 UTSW 7 96895550 missense probably damaging 1.00
R6937:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R6939:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7011:Tenm4 UTSW 7 96896135 nonsense probably null
R7033:Tenm4 UTSW 7 96895223 nonsense probably null
R7040:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7083:Tenm4 UTSW 7 96895349 missense probably damaging 1.00
R7238:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96553496 missense probably benign 0.01
R7239:Tenm4 UTSW 7 96735813 missense possibly damaging 0.47
R7337:Tenm4 UTSW 7 96874126 missense probably benign 0.44
R7400:Tenm4 UTSW 7 96694803 missense probably damaging 0.97
X0021:Tenm4 UTSW 7 96873909 nonsense probably null
X0026:Tenm4 UTSW 7 96868087 missense probably damaging 0.98
X0066:Tenm4 UTSW 7 96848030 missense probably damaging 1.00
X0066:Tenm4 UTSW 7 96894794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTGACCCTTGTTCCTAGCAAC -3'
(R):5'- GGCTTAACAGCAAGACCTGCTAACC -3'

Sequencing Primer
(F):5'- TGTTCCTAGCAACAACTGGC -3'
(R):5'- ACCTGCTAACCAGCTAGGTG -3'
Posted On2014-01-05