Incidental Mutation 'R1037:4933405L10Rik'
ID93870
Institutional Source Beutler Lab
Gene Symbol 4933405L10Rik
Ensembl Gene ENSMUSG00000013158
Gene NameRIKEN cDNA 4933405L10 gene
Synonyms
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1037 (G1)
Quality Score115
Status Validated
Chromosome8
Chromosomal Location105707655-105710246 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105709512 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 139 (S139G)
Ref Sequence ENSEMBL: ENSMUSP00000148838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013294] [ENSMUST00000013299] [ENSMUST00000013302] [ENSMUST00000211852] [ENSMUST00000212061]
Predicted Effect probably benign
Transcript: ENSMUST00000013294
SMART Domains Protein: ENSMUSP00000013294
Gene: ENSMUSG00000013150

DomainStartEndE-ValueType
Pfam:GFO_IDH_MocA 6 119 3.7e-14 PFAM
low complexity region 169 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000013299
SMART Domains Protein: ENSMUSP00000013299
Gene: ENSMUSG00000013155

DomainStartEndE-ValueType
low complexity region 220 236 N/A INTRINSIC
Pfam:Enkurin 243 339 6.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000013302
AA Change: S139G

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000013302
Gene: ENSMUSG00000013158
AA Change: S139G

DomainStartEndE-ValueType
Pfam:DUF4691 1 162 3.3e-71 PFAM
low complexity region 200 216 N/A INTRINSIC
low complexity region 252 275 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211852
AA Change: S139G

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000212061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212716
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in 4933405L10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01738:4933405L10Rik APN 8 105710036 missense probably damaging 0.98
IGL01845:4933405L10Rik APN 8 105708935 missense probably benign
R0096:4933405L10Rik UTSW 8 105708931 unclassified probably null
R0096:4933405L10Rik UTSW 8 105708931 unclassified probably null
R0396:4933405L10Rik UTSW 8 105709780 missense probably benign 0.06
R0711:4933405L10Rik UTSW 8 105708931 unclassified probably null
R1816:4933405L10Rik UTSW 8 105709859 missense possibly damaging 0.50
R1843:4933405L10Rik UTSW 8 105708974 missense probably damaging 0.98
R4332:4933405L10Rik UTSW 8 105709724 missense possibly damaging 0.92
R4868:4933405L10Rik UTSW 8 105710097 makesense probably null
R5072:4933405L10Rik UTSW 8 105709569 missense possibly damaging 0.71
R5285:4933405L10Rik UTSW 8 105708465 missense probably benign
R5656:4933405L10Rik UTSW 8 105709512 missense probably benign 0.32
R6196:4933405L10Rik UTSW 8 105709922 missense possibly damaging 0.92
R6524:4933405L10Rik UTSW 8 105709009 missense possibly damaging 0.71
R6657:4933405L10Rik UTSW 8 105708818 missense probably damaging 0.98
Z1088:4933405L10Rik UTSW 8 105709763 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCCGGAGATTCCTAAATCCCC -3'
(R):5'- TAGAACACCAGGCTGTGCCATGTC -3'

Sequencing Primer
(F):5'- AAATGCTGAGCCTCTACTGG -3'
(R):5'- TGCCATGTCAGCCTCAGAAG -3'
Posted On2014-01-05