Incidental Mutation 'R1037:Eepd1'
ID93872
Institutional Source Beutler Lab
Gene Symbol Eepd1
Ensembl Gene ENSMUSG00000036611
Gene Nameendonuclease/exonuclease/phosphatase family domain containing 1
Synonyms
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R1037 (G1)
Quality Score192
Status Validated
Chromosome9
Chromosomal Location25481547-25604110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25586783 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 388 (L388P)
Ref Sequence ENSEMBL: ENSMUSP00000047083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040677]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040677
AA Change: L388P

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047083
Gene: ENSMUSG00000036611
AA Change: L388P

DomainStartEndE-ValueType
HhH1 48 67 1.45e-1 SMART
HhH1 78 97 2.55e2 SMART
low complexity region 124 135 N/A INTRINSIC
HhH1 145 164 6.66e-1 SMART
Pfam:Exo_endo_phos 264 535 6.6e-8 PFAM
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Eepd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Eepd1 APN 9 25482482 missense probably damaging 1.00
IGL02110:Eepd1 APN 9 25603402 splice site probably benign
IGL02113:Eepd1 APN 9 25482713 missense probably damaging 1.00
IGL02188:Eepd1 APN 9 25581892 missense probably benign 0.01
IGL02930:Eepd1 APN 9 25483240 missense probably damaging 0.96
IGL03293:Eepd1 APN 9 25603412 missense possibly damaging 0.90
IGL03046:Eepd1 UTSW 9 25482685 missense probably damaging 1.00
R0970:Eepd1 UTSW 9 25603426 missense probably damaging 1.00
R1441:Eepd1 UTSW 9 25483203 missense probably benign
R1835:Eepd1 UTSW 9 25482868 missense possibly damaging 0.84
R3912:Eepd1 UTSW 9 25483304 missense probably damaging 1.00
R4245:Eepd1 UTSW 9 25594624 missense probably benign 0.00
R4704:Eepd1 UTSW 9 25482826 missense probably benign
R4838:Eepd1 UTSW 9 25589460 missense possibly damaging 0.56
R5153:Eepd1 UTSW 9 25586753 missense probably benign 0.37
R5634:Eepd1 UTSW 9 25603553 missense probably benign 0.12
R5994:Eepd1 UTSW 9 25603453 missense probably damaging 1.00
R6141:Eepd1 UTSW 9 25482984 missense probably benign 0.00
R6709:Eepd1 UTSW 9 25482868 missense probably benign 0.26
R7063:Eepd1 UTSW 9 25483036 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTTGCCTCGTGCCATGTAGTC -3'
(R):5'- TTCACTCCTGCCCTGTAGAAGGTC -3'

Sequencing Primer
(F):5'- GCCATGTAGTCGTTCAAATGC -3'
(R):5'- CTGTAGAAGGTCACCTACCAGG -3'
Posted On2014-01-05