Incidental Mutation 'R1037:Opcml'
ID93873
Institutional Source Beutler Lab
Gene Symbol Opcml
Ensembl Gene ENSMUSG00000062257
Gene Nameopioid binding protein/cell adhesion molecule-like
SynonymsObcam, B930023M13Rik, 2900075O15Rik, LOC235104
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1037 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27790775-28925410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28903299 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 290 (D290E)
Ref Sequence ENSEMBL: ENSMUSP00000073493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073822] [ENSMUST00000115243]
Predicted Effect probably damaging
Transcript: ENSMUST00000073822
AA Change: D290E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073493
Gene: ENSMUSG00000062257
AA Change: D290E

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 42 133 2.94e-10 SMART
IGc2 148 209 2.91e-14 SMART
IGc2 235 303 2e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115243
AA Change: D282E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110898
Gene: ENSMUSG00000062257
AA Change: D282E

DomainStartEndE-ValueType
IG 35 126 2.94e-10 SMART
IGc2 141 201 1.36e-14 SMART
IGc2 227 295 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215483
Meta Mutation Damage Score 0.15 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hist1h2bn T A 13: 21,754,247 V42E probably damaging Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Opcml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Opcml APN 9 28901590 missense probably damaging 1.00
IGL00864:Opcml APN 9 28901591 missense probably damaging 1.00
IGL00956:Opcml APN 9 28675328 missense possibly damaging 0.86
IGL02391:Opcml APN 9 28675264 missense probably damaging 0.96
IGL03210:Opcml APN 9 28901537 missense probably damaging 0.99
R0373:Opcml UTSW 9 28813398 missense possibly damaging 0.48
R1564:Opcml UTSW 9 28903316 missense probably damaging 1.00
R2094:Opcml UTSW 9 28901590 missense probably damaging 1.00
R2268:Opcml UTSW 9 28903355 missense possibly damaging 0.91
R2426:Opcml UTSW 9 28903367 critical splice donor site probably null
R2938:Opcml UTSW 9 27791386 start codon destroyed probably null 0.00
R3746:Opcml UTSW 9 28901530 missense possibly damaging 0.54
R4058:Opcml UTSW 9 28901588 missense probably damaging 1.00
R4173:Opcml UTSW 9 28903358 missense probably benign
R4882:Opcml UTSW 9 28901590 missense probably damaging 1.00
R5335:Opcml UTSW 9 28675325 missense possibly damaging 0.88
R7058:Opcml UTSW 9 28675211 nonsense probably null
R7559:Opcml UTSW 9 28903324 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATCCTTTGAGTGCCTGCTG -3'
(R):5'- ACCTTGGACACATGACTGCATGG -3'

Sequencing Primer
(F):5'- GAGTGCCTGCTGCTTCTC -3'
(R):5'- GGGTTGAGCAATATGGATGGAAAC -3'
Posted On2014-01-05