Incidental Mutation 'R1037:Hist1h2bn'
ID93887
Institutional Source Beutler Lab
Gene Symbol Hist1h2bn
Ensembl Gene ENSMUSG00000095217
Gene Namehistone cluster 1, H2bn
Synonyms
MMRRC Submission 039136-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1037 (G1)
Quality Score106
Status Not validated
Chromosome13
Chromosomal Location21754123-21754503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21754247 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 42 (V42E)
Ref Sequence ENSEMBL: ENSMUSP00000089301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074752] [ENSMUST00000091709] [ENSMUST00000102983]
Predicted Effect probably benign
Transcript: ENSMUST00000074752
SMART Domains Protein: ENSMUSP00000074310
Gene: ENSMUSG00000063021

DomainStartEndE-ValueType
H2A 3 123 1.22e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091709
AA Change: V42E

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000089301
Gene: ENSMUSG00000095217
AA Change: V42E

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 4.64e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102983
SMART Domains Protein: ENSMUSP00000100048
Gene: ENSMUSG00000064288

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198541
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.1%
  • 10x: 94.3%
  • 20x: 85.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,709,512 S139G probably benign Het
Abca2 T A 2: 25,438,228 probably benign Het
Abcb1b A T 5: 8,825,657 N610I probably benign Het
Ahnak T C 19: 9,007,618 F2089L probably benign Het
Cacnb1 T C 11: 98,005,017 probably benign Het
Cep57 T C 9: 13,818,979 I61V possibly damaging Het
Ckap5 T C 2: 91,550,629 I110T probably benign Het
Clasp2 T C 9: 113,896,634 probably benign Het
Col11a1 A C 3: 114,194,152 E265A probably damaging Het
Cst13 A G 2: 148,830,331 probably benign Het
Cyp24a1 G A 2: 170,491,617 T272M probably damaging Het
Cyp4a14 A C 4: 115,489,996 L415R probably damaging Het
Dbnl T C 11: 5,796,807 F179S probably damaging Het
Eepd1 T C 9: 25,586,783 L388P possibly damaging Het
Exosc8 G T 3: 54,732,738 A55E probably damaging Het
Fam72a G A 1: 131,533,819 V81I probably damaging Het
Fasn C T 11: 120,809,451 M2182I probably benign Het
Fras1 C T 5: 96,714,463 P2234S probably damaging Het
Grn C A 11: 102,433,070 D33E possibly damaging Het
Gsap A G 5: 21,251,165 probably benign Het
Hook3 T C 8: 26,072,350 Q229R possibly damaging Het
Itgb6 T C 2: 60,650,068 E308G probably damaging Het
Kmo C T 1: 175,651,618 P240L possibly damaging Het
Lrrc4c A G 2: 97,629,985 M319V probably benign Het
Mia3 T C 1: 183,357,354 I672M probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Mlc1 A G 15: 88,965,461 L223P probably damaging Het
Mmp21 T C 7: 133,674,453 K554E probably benign Het
Nup160 C T 2: 90,693,902 T383I probably damaging Het
Olfr1166 A G 2: 88,124,229 I252T probably damaging Het
Olfr1197 T A 2: 88,729,032 D189V probably damaging Het
Olfr177 T C 16: 58,872,970 Y60C probably damaging Het
Olfr201 C T 16: 59,268,944 C241Y probably damaging Het
Olfr516 T A 7: 108,845,984 T9S probably benign Het
Opcml T A 9: 28,903,299 D290E probably damaging Het
Palm3 C A 8: 84,029,272 T471K probably benign Het
Prl2c5 T A 13: 13,185,907 L50* probably null Het
Pzp T C 6: 128,519,426 N281S probably benign Het
Qser1 T C 2: 104,760,555 Y1722C probably damaging Het
Ryr3 A G 2: 112,869,108 V879A probably benign Het
Sbno1 A G 5: 124,393,912 S736P possibly damaging Het
Sept5 G A 16: 18,623,094 probably benign Het
Slc17a6 A G 7: 51,649,248 probably benign Het
Spag17 A T 3: 100,103,117 T1976S probably benign Het
Swt1 A T 1: 151,370,569 probably benign Het
Tenm4 T C 7: 96,797,481 W853R probably damaging Het
Thbs1 A T 2: 118,123,051 Q983L probably damaging Het
Tmem191c A G 16: 17,276,483 probably benign Het
Tmprss11g A T 5: 86,490,747 V294D probably damaging Het
Tor1aip2 A G 1: 156,065,336 S463G probably benign Het
Trim36 A G 18: 46,196,318 probably benign Het
Ttc1 A G 11: 43,730,499 V285A possibly damaging Het
Uckl1 C T 2: 181,572,485 R303H possibly damaging Het
Vwa8 C A 14: 79,086,654 C1132* probably null Het
Other mutations in Hist1h2bn
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Hist1h2bn UTSW 13 21754478 missense probably benign 0.11
R2189:Hist1h2bn UTSW 13 21754277 missense probably damaging 1.00
R6379:Hist1h2bn UTSW 13 21754418 missense probably benign 0.05
R6415:Hist1h2bn UTSW 13 21754486 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGCCTGCTCAGTAAGTGGTTTGAAG -3'
(R):5'- TACTTGGTGACAGCCTTGGTGC -3'

Sequencing Primer
(F):5'- GATGACGACTGCTAATTCGC -3'
(R):5'- TTGGTGCCCTCCGACAC -3'
Posted On2014-01-05