Incidental Mutation 'R1051:Myo5c'
ID93971
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission 039141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1051 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75290883 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1330 (M1330K)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably benign
Transcript: ENSMUST00000036555
AA Change: M1330K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: M1330K

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215620
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Acot1 T C 12: 84,009,604 V32A probably damaging Het
Ank1 G A 8: 23,093,940 G353D probably damaging Het
Baiap2l1 T A 5: 144,286,133 H97L probably damaging Het
Casp8ap2 C A 4: 32,640,790 P615T probably benign Het
Chrng A T 1: 87,209,063 D218V possibly damaging Het
Col5a3 C A 9: 20,775,235 V1365L unknown Het
Ddx49 A G 8: 70,294,685 probably null Het
Dnaaf2 T C 12: 69,197,795 D164G probably damaging Het
Eefsec A T 6: 88,297,847 D378E probably benign Het
Farsb T C 1: 78,443,650 I535V possibly damaging Het
Fat1 T G 8: 45,044,506 S4343A probably damaging Het
Fbn2 T C 18: 58,012,353 Y2737C probably damaging Het
Gtf3c1 T C 7: 125,707,649 E10G probably damaging Het
Has1 T C 17: 17,848,279 D271G probably damaging Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il12rb2 A G 6: 67,356,735 F187L probably benign Het
Kdsr G A 1: 106,747,580 Q109* probably null Het
Klb G A 5: 65,379,327 A667T probably damaging Het
Krba1 C T 6: 48,413,398 R704C possibly damaging Het
Lenep A T 3: 89,402,473 I56N possibly damaging Het
Lipc T C 9: 70,802,116 I450V probably benign Het
Myh6 T C 14: 54,949,527 N1329S probably benign Het
Myo9b A G 8: 71,355,822 E1691G probably damaging Het
Ninl C G 2: 150,970,126 E240Q probably damaging Het
Nlgn1 T C 3: 25,912,705 S195G probably damaging Het
Nlrp4c A G 7: 6,065,943 E281G probably benign Het
Olfm2 T C 9: 20,668,463 T331A probably damaging Het
Olfr107 A T 17: 37,406,450 I301F possibly damaging Het
Olfr715 T A 7: 107,128,916 D159V possibly damaging Het
Olfr877 T C 9: 37,855,361 I181T probably damaging Het
Plekhh2 T C 17: 84,521,827 probably null Het
Pramel4 A G 4: 144,068,498 E485G possibly damaging Het
Prss12 A G 3: 123,485,525 D417G probably null Het
Rhpn1 A T 15: 75,712,392 Y456F probably damaging Het
Rnpc3 C T 3: 113,629,946 E37K possibly damaging Het
Rp1l1 T G 14: 64,032,535 L1857V probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sepsecs C T 5: 52,665,356 A18T probably damaging Het
Sgms1 T A 19: 32,160,039 L42F probably damaging Het
Sipa1l1 A T 12: 82,449,345 D1720V possibly damaging Het
Slc13a3 A T 2: 165,408,820 probably null Het
Slc25a40 A T 5: 8,430,450 M67L probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Spesp1 T C 9: 62,272,642 D328G possibly damaging Het
Sspo T A 6: 48,491,455 C4363* probably null Het
Tbc1d8 C T 1: 39,381,453 W666* probably null Het
Tubgcp2 T C 7: 139,998,896 D721G probably benign Het
Vps54 CTTAAT CT 11: 21,278,001 probably null Het
Wsb1 T C 11: 79,246,233 S113G probably damaging Het
Zfp382 T C 7: 30,134,010 F362S probably damaging Het
Zfp553 G T 7: 127,236,805 G511* probably null Het
Zfp568 C T 7: 30,022,529 Q299* probably null Het
Zfp688 G A 7: 127,419,225 P243S probably damaging Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTAATACAGAAAACAACTGCTGTGC -3'
(R):5'- ACAGACATTGGGATACTCAGAGATCCG -3'

Sequencing Primer
(F):5'- GAAAACAACTGCTGTGCAAATC -3'
(R):5'- GATACTCAGAGATCCGCTATCTGTG -3'
Posted On2014-01-05