Incidental Mutation 'R1052:Zfp335'
ID94023
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1052 (G1)
Quality Score114
Status Not validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) GTCCTCCTCCTCCTCCTC to GTCCTCCTCCTCCTC at 164907468 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000139247] [ENSMUST00000183830]
Predicted Effect probably benign
Transcript: ENSMUST00000041361
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129364
Predicted Effect probably benign
Transcript: ENSMUST00000139247
SMART Domains Protein: ENSMUSP00000138664
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adam19 T C 11: 46,127,265 F385L probably damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACACCCAGCTTTACTAAGCGTTC -3'
(R):5'- TCAAGTGCAAGATGTGCCAGTACC -3'

Sequencing Primer
(F):5'- TGCACTGAATAGTTTGGAAGCAC -3'
(R):5'- ATGTGCCAGTACCGGAGC -3'
Posted On2014-01-05