Incidental Mutation 'R1052:Adam19'
ID94071
Institutional Source Beutler Lab
Gene Symbol Adam19
Ensembl Gene ENSMUSG00000011256
Gene Namea disintegrin and metallopeptidase domain 19 (meltrin beta)
SynonymsMltnb
MMRRC Submission 039142-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1052 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location46055992-46147343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46127265 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 385 (F385L)
Ref Sequence ENSEMBL: ENSMUSP00000011400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011400]
Predicted Effect probably damaging
Transcript: ENSMUST00000011400
AA Change: F385L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000011400
Gene: ENSMUSG00000011256
AA Change: F385L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pep_M12B_propep 32 163 9.4e-27 PFAM
Pfam:Reprolysin_5 209 388 1.9e-25 PFAM
Pfam:Reprolysin_4 209 399 1.5e-15 PFAM
Pfam:Reprolysin 211 409 1.3e-68 PFAM
Pfam:Reprolysin_2 231 399 6.1e-19 PFAM
Pfam:Reprolysin_3 235 357 1.2e-19 PFAM
DISIN 426 501 9.7e-41 SMART
ACR 502 650 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
low complexity region 788 797 N/A INTRINSIC
low complexity region 832 846 N/A INTRINSIC
low complexity region 886 905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151565
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a cell surface glycoprotein and member of the ADAM (a disintegrin and metalloproteinase) family of endopeptidases. The encoded protein may play a role in the ectodomain shedding of neuregulin proteins. Homozygous knockout mice for this gene exhibit heart development defects and perinatal lethality. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that undergoes proteolytic processing to generate a mature protein product. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice exhibit cardiac developmental defects and die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,705,072 Y528F possibly damaging Het
Acad10 G A 5: 121,649,541 T115I possibly damaging Het
Adgb T C 10: 10,442,613 N162D probably benign Het
Arhgap20 C A 9: 51,846,270 P521T probably damaging Het
Arsa A T 15: 89,475,177 L134Q probably damaging Het
Atp5b A G 10: 128,090,052 Y508C probably damaging Het
AW554918 G A 18: 25,420,010 M287I probably benign Het
Bmp4 T C 14: 46,383,903 K395E probably damaging Het
Cacna2d4 A G 6: 119,300,333 Y669C probably damaging Het
Casq2 T C 3: 102,144,234 probably null Het
Cdk5rap1 A T 2: 154,360,599 I237N possibly damaging Het
Cerk G C 15: 86,149,364 S286C possibly damaging Het
Cir1 A C 2: 73,287,643 L186R probably damaging Het
Csf3r A T 4: 126,042,988 probably null Het
Cyp3a41a A T 5: 145,705,811 I246K possibly damaging Het
Cyp8b1 A G 9: 121,915,282 F328S possibly damaging Het
Dzank1 A T 2: 144,513,445 V110D probably benign Het
Gm13089 T C 4: 143,696,907 I437M possibly damaging Het
Gm6729 T A 10: 86,540,935 noncoding transcript Het
Gnpat T C 8: 124,877,507 F246L probably benign Het
Gnpat T A 8: 124,878,516 L248H probably damaging Het
Gstm7 T C 3: 107,926,950 T163A probably benign Het
Hspa5 A G 2: 34,775,098 T424A probably damaging Het
Itgb1 T G 8: 128,713,305 D158E probably damaging Het
Kif21a A G 15: 90,935,650 V1637A probably benign Het
Kl G T 5: 150,982,520 V452F probably damaging Het
Krt23 T C 11: 99,478,219 N416S probably benign Het
Lama4 A T 10: 39,092,245 H1461L possibly damaging Het
Lamc3 A G 2: 31,928,802 T1180A probably benign Het
Mboat2 T C 12: 24,946,528 Y145H probably damaging Het
Mlxipl T A 5: 135,113,710 I126N probably damaging Het
Myo16 T A 8: 10,570,181 N1577K possibly damaging Het
Nlrp4f A G 13: 65,185,083 V87A possibly damaging Het
Olfr1039 A G 2: 86,131,571 F31L probably benign Het
Olfr414 A T 1: 174,431,135 K236* probably null Het
Pask A T 1: 93,330,827 D266E probably benign Het
Pcdhb17 A G 18: 37,486,846 Y563C probably damaging Het
Pdlim3 T A 8: 45,896,800 I49N probably damaging Het
Pla2g4c T A 7: 13,343,409 V292E possibly damaging Het
Prrt4 G T 6: 29,169,814 Q880K possibly damaging Het
Pygb A G 2: 150,786,938 D24G probably benign Het
R3hcc1l T A 19: 42,563,654 D363E probably damaging Het
Rif1 A C 2: 52,111,562 Q1676P probably benign Het
Ryr1 C A 7: 29,096,258 R1069L probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Slc2a13 A G 15: 91,412,160 V317A probably damaging Het
Slc35b4 A T 6: 34,161,684 F197I probably damaging Het
Tchhl1 G A 3: 93,470,213 V75I probably benign Het
Ubr4 T C 4: 139,455,460 S3521P possibly damaging Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp335 GTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTC 2: 164,907,468 probably benign Het
Zfp874a T G 13: 67,442,420 I382L possibly damaging Het
Other mutations in Adam19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Adam19 APN 11 46112783 missense probably damaging 1.00
IGL01727:Adam19 APN 11 46121553 missense probably benign
IGL01758:Adam19 APN 11 46112924 missense probably benign 0.01
IGL02160:Adam19 APN 11 46139695 missense probably damaging 0.99
IGL02421:Adam19 APN 11 46137553 missense probably damaging 0.96
IGL02572:Adam19 APN 11 46131721 nonsense probably null
IGL02995:Adam19 APN 11 46136349 missense probably benign 0.00
IGL03171:Adam19 APN 11 46138854 missense probably damaging 0.98
IGL03237:Adam19 APN 11 46137556 missense probably benign
R0003:Adam19 UTSW 11 46128789 missense probably damaging 1.00
R0026:Adam19 UTSW 11 46136259 missense probably damaging 1.00
R0158:Adam19 UTSW 11 46143034 missense probably damaging 1.00
R0304:Adam19 UTSW 11 46127392 missense possibly damaging 0.91
R0488:Adam19 UTSW 11 46138930 missense probably damaging 0.98
R0501:Adam19 UTSW 11 46123130 missense probably damaging 1.00
R0591:Adam19 UTSW 11 46121411 splice site probably benign
R0734:Adam19 UTSW 11 46127403 missense probably damaging 0.99
R0747:Adam19 UTSW 11 46118495 splice site probably null
R0771:Adam19 UTSW 11 46121453 missense possibly damaging 0.92
R1573:Adam19 UTSW 11 46113618 splice site probably benign
R1735:Adam19 UTSW 11 46138917 missense probably benign 0.26
R1830:Adam19 UTSW 11 46127278 missense probably damaging 0.98
R1911:Adam19 UTSW 11 46121454 missense probably damaging 1.00
R2092:Adam19 UTSW 11 46060904 intron probably null
R3749:Adam19 UTSW 11 46137610 missense probably benign 0.00
R3893:Adam19 UTSW 11 46128838 missense probably damaging 1.00
R3916:Adam19 UTSW 11 46060935 missense probably benign 0.25
R3917:Adam19 UTSW 11 46060935 missense probably benign 0.25
R4506:Adam19 UTSW 11 46118444 missense possibly damaging 0.67
R4767:Adam19 UTSW 11 46138977 critical splice donor site probably null
R5055:Adam19 UTSW 11 46123169 missense probably damaging 1.00
R5313:Adam19 UTSW 11 46131776 missense probably damaging 1.00
R5329:Adam19 UTSW 11 46125026 missense probably damaging 0.99
R5567:Adam19 UTSW 11 46136250 missense probably damaging 1.00
R5602:Adam19 UTSW 11 46136315 missense probably benign
R6198:Adam19 UTSW 11 46121502 missense probably damaging 1.00
R6875:Adam19 UTSW 11 46112875 missense probably benign
R7011:Adam19 UTSW 11 46143018 missense probably benign 0.00
R7163:Adam19 UTSW 11 46131717 missense probably benign
R7213:Adam19 UTSW 11 46121471 missense probably benign 0.20
R7267:Adam19 UTSW 11 46121576 nonsense probably null
X0067:Adam19 UTSW 11 46056115 start codon destroyed probably null 0.06
Predicted Primers PCR Primer
(F):5'- GTACTGATGAATGTCCTGGTGAGGC -3'
(R):5'- GGACCGCATTGTCCTTTTGATAGGAAC -3'

Sequencing Primer
(F):5'- TCCTGGTGAGGCAGAGG -3'
(R):5'- GCTCTGAAGACAATACAGATTCGTC -3'
Posted On2014-01-05