Incidental Mutation 'R1053:Fbxl4'
ID94105
Institutional Source Beutler Lab
Gene Symbol Fbxl4
Ensembl Gene ENSMUSG00000040410
Gene NameF-box and leucine-rich repeat protein 4
SynonymsFBL5, FBL4
MMRRC Submission 039143-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R1053 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location22357543-22434091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22427166 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 469 (V469E)
Ref Sequence ENSEMBL: ENSMUSP00000139158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039234] [ENSMUST00000184455] [ENSMUST00000184582] [ENSMUST00000185029]
Predicted Effect probably benign
Transcript: ENSMUST00000039234
AA Change: V469E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042219
Gene: ENSMUSG00000040410
AA Change: V469E

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
LRR 558 583 8.71e0 SMART
LRR 584 609 1.64e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184455
Predicted Effect probably benign
Transcript: ENSMUST00000184582
AA Change: V469E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139158
Gene: ENSMUSG00000040410
AA Change: V469E

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-6 BLAST
LRR 400 425 1.95e-3 SMART
LRR 450 475 1.01e-1 SMART
LRR_CC 478 503 4.14e-7 SMART
LRR 504 524 1.16e2 SMART
LRR 532 557 3.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185029
SMART Domains Protein: ENSMUSP00000138825
Gene: ENSMUSG00000040410

DomainStartEndE-ValueType
FBOX 283 325 2.11e-3 SMART
Blast:LRR 344 372 1e-7 BLAST
Blast:LRR 400 425 2e-9 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which are characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one subunit of modular E3 ubiquitin ligase complexes, called SCF complexes, which function in phosphorylation-dependent ubiquitination. The F-box domain mediates protein-protein interactions and binds directly to S-phase kinase-associated protein 1. In addition to an F-box domain, the encoded protein contains at least 9 tandem leucine-rich repeats. The ubiquitin ligase complex containing the encoded protein may function in cell-cycle control by regulating levels of lysine-specific demethylase 4A. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam25 A T 8: 40,754,731 N345Y probably benign Het
Ampd3 G A 7: 110,788,680 G107S probably damaging Het
Bcas3 T A 11: 85,557,410 I632N probably benign Het
Cald1 G T 6: 34,755,642 R83L probably damaging Het
Cds2 T A 2: 132,305,260 L420Q probably damaging Het
Col6a1 A T 10: 76,720,966 Y266N probably damaging Het
Ctps A G 4: 120,543,722 probably null Het
Enam A G 5: 88,504,019 N1129S possibly damaging Het
Erc1 T C 6: 119,796,926 E356G probably damaging Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm11568 A G 11: 99,858,061 T31A unknown Het
Grm2 T G 9: 106,648,157 Y453S probably damaging Het
Htt A G 5: 34,851,217 probably null Het
Jakmip1 A G 5: 37,134,249 I681V possibly damaging Het
Lair1 A G 7: 4,028,785 S108P probably damaging Het
Lrp12 A C 15: 39,877,981 F446C probably damaging Het
Ncoa6 C T 2: 155,434,040 R95Q probably damaging Het
Nup210 T C 6: 91,028,811 T614A probably benign Het
Olfr362 T C 2: 37,105,464 Y62C probably damaging Het
Olfr551 A T 7: 102,587,959 Y261* probably null Het
Olfr874 T C 9: 37,746,835 S234P probably damaging Het
Ppp1r12a T C 10: 108,262,351 S311P probably damaging Het
Rsph3a C A 17: 7,945,904 P32Q probably benign Het
Sorl1 T C 9: 41,991,456 T1602A probably benign Het
Svil C G 18: 5,056,690 P521R probably benign Het
Vps13b A G 15: 35,652,363 Y1580C probably damaging Het
Vwce T C 19: 10,664,099 F730L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zc2hc1c A G 12: 85,296,556 D489G probably damaging Het
Other mutations in Fbxl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Fbxl4 APN 4 22427348 missense probably benign 0.01
IGL01973:Fbxl4 APN 4 22422766 missense probably damaging 1.00
IGL02353:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02360:Fbxl4 APN 4 22433684 missense probably benign 0.00
IGL02871:Fbxl4 APN 4 22386213 missense probably benign
R0033:Fbxl4 UTSW 4 22377017 missense probably damaging 1.00
R0379:Fbxl4 UTSW 4 22386106 missense probably benign 0.01
R1527:Fbxl4 UTSW 4 22386154 missense probably benign 0.00
R1768:Fbxl4 UTSW 4 22385950 missense probably benign 0.00
R2148:Fbxl4 UTSW 4 22427333 missense possibly damaging 0.65
R2196:Fbxl4 UTSW 4 22403624 missense probably benign
R2850:Fbxl4 UTSW 4 22403624 missense probably benign
R4024:Fbxl4 UTSW 4 22377074 missense possibly damaging 0.83
R4425:Fbxl4 UTSW 4 22422699 intron probably null
R5227:Fbxl4 UTSW 4 22376840 missense probably damaging 1.00
R5499:Fbxl4 UTSW 4 22386017 missense probably damaging 1.00
R5595:Fbxl4 UTSW 4 22433641 missense probably damaging 1.00
R5895:Fbxl4 UTSW 4 22390678 missense probably damaging 1.00
R6475:Fbxl4 UTSW 4 22433661 missense probably damaging 1.00
R6697:Fbxl4 UTSW 4 22376599 missense probably benign 0.33
R6977:Fbxl4 UTSW 4 22376930 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AGCTTTGGGATGGGTAAGCAAATGT -3'
(R):5'- CCAGGAAGGTGGCTCTGGTGTA -3'

Sequencing Primer
(F):5'- TGTGCATTAACCAGGACATGG -3'
(R):5'- TGTGTCACACACAGACCTGTTAG -3'
Posted On2014-01-05