Incidental Mutation 'R1053:Adam25'
ID94122
Institutional Source Beutler Lab
Gene Symbol Adam25
Ensembl Gene ENSMUSG00000071937
Gene Namea disintegrin and metallopeptidase domain 25 (testase 2)
Synonymstestase 2
MMRRC Submission 039143-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1053 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40752208-40756176 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40754731 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 345 (N345Y)
Ref Sequence ENSEMBL: ENSMUSP00000094420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096663]
Predicted Effect probably benign
Transcript: ENSMUST00000096663
AA Change: N345Y

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000094420
Gene: ENSMUSG00000071937
AA Change: N345Y

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 53 179 3.4e-21 PFAM
Pfam:Reprolysin_5 220 398 1.6e-16 PFAM
Pfam:Reprolysin_4 220 407 2.5e-13 PFAM
Pfam:Reprolysin 221 410 5.6e-46 PFAM
Pfam:Reprolysin_2 222 399 9.7e-14 PFAM
Pfam:Reprolysin_3 246 366 1e-18 PFAM
DISIN 428 503 3.33e-39 SMART
ACR 504 640 8.95e-74 SMART
transmembrane domain 706 728 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ampd3 G A 7: 110,788,680 G107S probably damaging Het
Bcas3 T A 11: 85,557,410 I632N probably benign Het
Cald1 G T 6: 34,755,642 R83L probably damaging Het
Cds2 T A 2: 132,305,260 L420Q probably damaging Het
Col6a1 A T 10: 76,720,966 Y266N probably damaging Het
Ctps A G 4: 120,543,722 probably null Het
Enam A G 5: 88,504,019 N1129S possibly damaging Het
Erc1 T C 6: 119,796,926 E356G probably damaging Het
Fbxl4 T A 4: 22,427,166 V469E probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm11568 A G 11: 99,858,061 T31A unknown Het
Grm2 T G 9: 106,648,157 Y453S probably damaging Het
Htt A G 5: 34,851,217 probably null Het
Jakmip1 A G 5: 37,134,249 I681V possibly damaging Het
Lair1 A G 7: 4,028,785 S108P probably damaging Het
Lrp12 A C 15: 39,877,981 F446C probably damaging Het
Ncoa6 C T 2: 155,434,040 R95Q probably damaging Het
Nup210 T C 6: 91,028,811 T614A probably benign Het
Olfr362 T C 2: 37,105,464 Y62C probably damaging Het
Olfr551 A T 7: 102,587,959 Y261* probably null Het
Olfr874 T C 9: 37,746,835 S234P probably damaging Het
Ppp1r12a T C 10: 108,262,351 S311P probably damaging Het
Rsph3a C A 17: 7,945,904 P32Q probably benign Het
Sorl1 T C 9: 41,991,456 T1602A probably benign Het
Svil C G 18: 5,056,690 P521R probably benign Het
Vps13b A G 15: 35,652,363 Y1580C probably damaging Het
Vwce T C 19: 10,664,099 F730L probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zc2hc1c A G 12: 85,296,556 D489G probably damaging Het
Other mutations in Adam25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Adam25 APN 8 40754921 missense probably benign
IGL01977:Adam25 APN 8 40755097 missense probably benign 0.00
IGL02098:Adam25 APN 8 40755643 missense probably benign 0.12
IGL02233:Adam25 APN 8 40755386 missense probably damaging 1.00
IGL02458:Adam25 APN 8 40753807 missense probably benign 0.01
IGL02527:Adam25 APN 8 40753748 missense possibly damaging 0.78
IGL02632:Adam25 APN 8 40755200 missense possibly damaging 0.90
IGL02995:Adam25 APN 8 40753723 missense probably benign 0.00
H8786:Adam25 UTSW 8 40754224 missense probably benign 0.00
R0062:Adam25 UTSW 8 40754792 missense probably damaging 1.00
R0062:Adam25 UTSW 8 40754792 missense probably damaging 1.00
R0189:Adam25 UTSW 8 40755430 missense probably damaging 1.00
R0505:Adam25 UTSW 8 40755224 missense probably damaging 1.00
R0532:Adam25 UTSW 8 40755950 missense probably benign 0.00
R0699:Adam25 UTSW 8 40755974 missense probably benign
R0972:Adam25 UTSW 8 40755131 missense probably damaging 1.00
R1079:Adam25 UTSW 8 40755476 missense possibly damaging 0.87
R1872:Adam25 UTSW 8 40755226 nonsense probably null
R1933:Adam25 UTSW 8 40754885 missense probably benign 0.01
R1934:Adam25 UTSW 8 40754885 missense probably benign 0.01
R4061:Adam25 UTSW 8 40753782 missense possibly damaging 0.67
R4702:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4703:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4705:Adam25 UTSW 8 40754126 missense probably damaging 1.00
R4859:Adam25 UTSW 8 40754543 missense probably benign 0.01
R5015:Adam25 UTSW 8 40754634 missense probably benign 0.22
R5249:Adam25 UTSW 8 40755954 missense probably benign
R5628:Adam25 UTSW 8 40755710 missense probably benign 0.00
R5791:Adam25 UTSW 8 40754220 missense probably benign
R6439:Adam25 UTSW 8 40754590 missense possibly damaging 0.92
R6693:Adam25 UTSW 8 40754531 missense probably damaging 1.00
R7041:Adam25 UTSW 8 40754084 missense probably benign 0.04
R7101:Adam25 UTSW 8 40755401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCACTCTGATGCAAAGCCACTATG -3'
(R):5'- TTGCCTCGGAGGATGCCTTTTGAC -3'

Sequencing Primer
(F):5'- atatttatGAGACACTGGATGTTGAG -3'
(R):5'- CGCATACACTTGGCAGTAGC -3'
Posted On2014-01-05