Incidental Mutation 'R1056:Lypd6b'
ID94330
Institutional Source Beutler Lab
Gene Symbol Lypd6b
Ensembl Gene ENSMUSG00000026765
Gene NameLY6/PLAUR domain containing 6B
Synonyms
MMRRC Submission 039146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R1056 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location49787688-49948849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49947456 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 147 (V147I)
Ref Sequence ENSEMBL: ENSMUSP00000028103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028103]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028103
AA Change: V147I

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028103
Gene: ENSMUSG00000026765
AA Change: V147I

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
LU 65 156 7.64e-2 SMART
low complexity region 167 177 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129867
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,983,453 H2469N possibly damaging Het
4932438A13Rik T A 3: 37,044,680 M1152K probably benign Het
Abca14 A G 7: 120,325,072 Y1649C probably damaging Het
Abcc10 A C 17: 46,303,954 C1459W possibly damaging Het
Amfr A T 8: 93,985,469 F278I probably benign Het
Anks1b G T 10: 90,921,429 probably null Het
Bak1 A G 17: 27,021,273 S147P possibly damaging Het
C7 T C 15: 5,045,778 N144S possibly damaging Het
Casd1 T C 6: 4,641,967 V748A probably benign Het
Ccdc180 T C 4: 45,916,375 S859P probably benign Het
Ccne2 T C 4: 11,192,707 S2P probably damaging Het
Cdc42bpg T A 19: 6,314,021 I541N probably benign Het
Cgnl1 T A 9: 71,725,895 N58I probably damaging Het
Chd7 T C 4: 8,822,402 S832P possibly damaging Het
Chl1 A T 6: 103,675,077 Y318F possibly damaging Het
Coq2 G T 5: 100,657,947 N274K probably benign Het
Crhr2 A T 6: 55,100,735 V214E probably damaging Het
Dgkg G C 16: 22,600,541 P70A probably damaging Het
Dync2h1 T C 9: 7,147,731 I966M probably benign Het
Eif5b C G 1: 38,022,167 R380G unknown Het
Fat4 T A 3: 38,891,392 I1478N probably damaging Het
Gm8251 C T 1: 44,060,927 G337D probably damaging Het
Impact A T 18: 12,976,524 I92L probably benign Het
Ly6c2 A G 15: 75,111,596 probably null Het
Mdga2 T C 12: 66,723,120 D192G probably damaging Het
Mms22l T C 4: 24,586,344 probably null Het
Myo9a C T 9: 59,832,201 T732I possibly damaging Het
Myrf C T 19: 10,223,486 M274I probably benign Het
Nfx1 G A 4: 41,003,057 R686Q probably damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr43 C T 11: 74,206,782 V145I probably benign Het
Olfr594 A T 7: 103,220,418 E233D probably benign Het
Oog4 T C 4: 143,438,011 T245A possibly damaging Het
Pclo A T 5: 14,540,055 K790* probably null Het
Pcm1 A G 8: 41,321,900 E1668G probably damaging Het
Pkhd1l1 T A 15: 44,591,964 N4040K probably damaging Het
Podnl1 T A 8: 84,129,276 S222T probably benign Het
Ppil4 A G 10: 7,799,632 T182A possibly damaging Het
Prdm13 T C 4: 21,678,544 K649E probably damaging Het
Prob1 A T 18: 35,653,610 H530Q probably benign Het
Rbbp4 A T 4: 129,317,649 M404K probably damaging Het
Rilpl1 A T 5: 124,493,837 F149I probably damaging Het
Sema6c T A 3: 95,171,216 S543T probably benign Het
Sh3rf3 G T 10: 59,007,082 W290L probably damaging Het
Slc2a12 T G 10: 22,665,451 S402A probably benign Het
Tas2r131 T A 6: 132,957,067 I260F possibly damaging Het
Tasp1 A G 2: 140,008,764 I113T possibly damaging Het
Tnrc18 G A 5: 142,773,859 R741* probably null Het
Ube2o G T 11: 116,546,464 D244E probably damaging Het
Vmn1r206 A T 13: 22,620,614 M141K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp747 A G 7: 127,374,588 S137P probably benign Het
Zfp951 A T 5: 104,815,285 H138Q possibly damaging Het
Other mutations in Lypd6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Lypd6b APN 2 49943630 splice site probably benign
R1174:Lypd6b UTSW 2 49943597 missense possibly damaging 0.89
R1510:Lypd6b UTSW 2 49934819 missense probably damaging 0.98
R1518:Lypd6b UTSW 2 49947492 missense probably damaging 0.99
R1550:Lypd6b UTSW 2 49943603 missense probably damaging 1.00
R1864:Lypd6b UTSW 2 49947447 missense possibly damaging 0.95
R3942:Lypd6b UTSW 2 49943540 missense probably damaging 1.00
R4942:Lypd6b UTSW 2 49946120 missense probably benign 0.25
R5988:Lypd6b UTSW 2 49946166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCCATCATAACAGGACTCAGG -3'
(R):5'- TGGGAACTGCATCATCATAGCAAGG -3'

Sequencing Primer
(F):5'- TCTGGAAACTGAGCAGTCTAACTC -3'
(R):5'- CATCATCATAGCAAGGGAAGC -3'
Posted On2014-01-05