Incidental Mutation 'R1056:Olfr594'
ID94367
Institutional Source Beutler Lab
Gene Symbol Olfr594
Ensembl Gene ENSMUSG00000073954
Gene Nameolfactory receptor 594
SynonymsGA_x6K02T2PBJ9-5935234-5936169, MOR32-10
MMRRC Submission 039146-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1056 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103216996-103222313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103220418 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 233 (E233D)
Ref Sequence ENSEMBL: ENSMUSP00000149847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098205] [ENSMUST00000214051]
Predicted Effect probably benign
Transcript: ENSMUST00000098205
AA Change: E233D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095806
Gene: ENSMUSG00000073954
AA Change: E233D

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 2.6e-130 PFAM
Pfam:7TM_GPCR_Srsx 37 284 4.6e-6 PFAM
Pfam:7tm_1 43 293 3.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214051
AA Change: E233D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,983,453 H2469N possibly damaging Het
4932438A13Rik T A 3: 37,044,680 M1152K probably benign Het
Abca14 A G 7: 120,325,072 Y1649C probably damaging Het
Abcc10 A C 17: 46,303,954 C1459W possibly damaging Het
Amfr A T 8: 93,985,469 F278I probably benign Het
Anks1b G T 10: 90,921,429 probably null Het
Bak1 A G 17: 27,021,273 S147P possibly damaging Het
C7 T C 15: 5,045,778 N144S possibly damaging Het
Casd1 T C 6: 4,641,967 V748A probably benign Het
Ccdc180 T C 4: 45,916,375 S859P probably benign Het
Ccne2 T C 4: 11,192,707 S2P probably damaging Het
Cdc42bpg T A 19: 6,314,021 I541N probably benign Het
Cgnl1 T A 9: 71,725,895 N58I probably damaging Het
Chd7 T C 4: 8,822,402 S832P possibly damaging Het
Chl1 A T 6: 103,675,077 Y318F possibly damaging Het
Coq2 G T 5: 100,657,947 N274K probably benign Het
Crhr2 A T 6: 55,100,735 V214E probably damaging Het
Dgkg G C 16: 22,600,541 P70A probably damaging Het
Dync2h1 T C 9: 7,147,731 I966M probably benign Het
Eif5b C G 1: 38,022,167 R380G unknown Het
Fat4 T A 3: 38,891,392 I1478N probably damaging Het
Gm8251 C T 1: 44,060,927 G337D probably damaging Het
Impact A T 18: 12,976,524 I92L probably benign Het
Ly6c2 A G 15: 75,111,596 probably null Het
Lypd6b G A 2: 49,947,456 V147I possibly damaging Het
Mdga2 T C 12: 66,723,120 D192G probably damaging Het
Mms22l T C 4: 24,586,344 probably null Het
Myo9a C T 9: 59,832,201 T732I possibly damaging Het
Myrf C T 19: 10,223,486 M274I probably benign Het
Nfx1 G A 4: 41,003,057 R686Q probably damaging Het
Ofcc1 C T 13: 40,208,829 G206R probably benign Het
Olfr43 C T 11: 74,206,782 V145I probably benign Het
Oog4 T C 4: 143,438,011 T245A possibly damaging Het
Pclo A T 5: 14,540,055 K790* probably null Het
Pcm1 A G 8: 41,321,900 E1668G probably damaging Het
Pkhd1l1 T A 15: 44,591,964 N4040K probably damaging Het
Podnl1 T A 8: 84,129,276 S222T probably benign Het
Ppil4 A G 10: 7,799,632 T182A possibly damaging Het
Prdm13 T C 4: 21,678,544 K649E probably damaging Het
Prob1 A T 18: 35,653,610 H530Q probably benign Het
Rbbp4 A T 4: 129,317,649 M404K probably damaging Het
Rilpl1 A T 5: 124,493,837 F149I probably damaging Het
Sema6c T A 3: 95,171,216 S543T probably benign Het
Sh3rf3 G T 10: 59,007,082 W290L probably damaging Het
Slc2a12 T G 10: 22,665,451 S402A probably benign Het
Tas2r131 T A 6: 132,957,067 I260F possibly damaging Het
Tasp1 A G 2: 140,008,764 I113T possibly damaging Het
Tnrc18 G A 5: 142,773,859 R741* probably null Het
Ube2o G T 11: 116,546,464 D244E probably damaging Het
Vmn1r206 A T 13: 22,620,614 M141K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp747 A G 7: 127,374,588 S137P probably benign Het
Zfp951 A T 5: 104,815,285 H138Q possibly damaging Het
Other mutations in Olfr594
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Olfr594 APN 7 103220351 missense probably damaging 1.00
IGL02732:Olfr594 APN 7 103220240 missense probably benign 0.01
IGL03268:Olfr594 APN 7 103220641 missense probably benign 0.09
R0008:Olfr594 UTSW 7 103220351 missense probably damaging 1.00
R0008:Olfr594 UTSW 7 103220377 missense probably benign 0.00
R1300:Olfr594 UTSW 7 103220117 missense probably benign 0.10
R1961:Olfr594 UTSW 7 103219997 missense probably benign
R2029:Olfr594 UTSW 7 103219760 missense probably damaging 0.97
R2380:Olfr594 UTSW 7 103220608 missense possibly damaging 0.93
R4616:Olfr594 UTSW 7 103220422 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCAGCAGTCCTCTTGGCAATGG -3'
(R):5'- TGACAGGATTAAGCATTGGTGGCAC -3'

Sequencing Primer
(F):5'- CAATGGCTTATGACCGCTATG -3'
(R):5'- GCATTGGTGGCACTACAAC -3'
Posted On2014-01-05