Incidental Mutation 'R1056:Ofcc1'
ID94399
Institutional Source Beutler Lab
Gene Symbol Ofcc1
Ensembl Gene ENSMUSG00000047094
Gene Nameorofacial cleft 1 candidate 1
SynonymsOpo, ojoplano
MMRRC Submission 039146-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1056 (G1)
Quality Score209
Status Not validated
Chromosome13
Chromosomal Location40001882-40361450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40208829 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 206 (G206R)
Ref Sequence ENSEMBL: ENSMUSP00000062217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054635] [ENSMUST00000224909]
Predicted Effect probably benign
Transcript: ENSMUST00000054635
AA Change: G206R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062217
Gene: ENSMUSG00000047094
AA Change: G206R

DomainStartEndE-ValueType
Pfam:OFCC1 5 113 1.3e-57 PFAM
transmembrane domain 575 592 N/A INTRINSIC
transmembrane domain 599 618 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000224909
AA Change: R180Q
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skull morphology and normal behavior with in increase in gamma-glutamyl transpeptidase. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,983,453 H2469N possibly damaging Het
4932438A13Rik T A 3: 37,044,680 M1152K probably benign Het
Abca14 A G 7: 120,325,072 Y1649C probably damaging Het
Abcc10 A C 17: 46,303,954 C1459W possibly damaging Het
Amfr A T 8: 93,985,469 F278I probably benign Het
Anks1b G T 10: 90,921,429 probably null Het
Bak1 A G 17: 27,021,273 S147P possibly damaging Het
C7 T C 15: 5,045,778 N144S possibly damaging Het
Casd1 T C 6: 4,641,967 V748A probably benign Het
Ccdc180 T C 4: 45,916,375 S859P probably benign Het
Ccne2 T C 4: 11,192,707 S2P probably damaging Het
Cdc42bpg T A 19: 6,314,021 I541N probably benign Het
Cgnl1 T A 9: 71,725,895 N58I probably damaging Het
Chd7 T C 4: 8,822,402 S832P possibly damaging Het
Chl1 A T 6: 103,675,077 Y318F possibly damaging Het
Coq2 G T 5: 100,657,947 N274K probably benign Het
Crhr2 A T 6: 55,100,735 V214E probably damaging Het
Dgkg G C 16: 22,600,541 P70A probably damaging Het
Dync2h1 T C 9: 7,147,731 I966M probably benign Het
Eif5b C G 1: 38,022,167 R380G unknown Het
Fat4 T A 3: 38,891,392 I1478N probably damaging Het
Gm8251 C T 1: 44,060,927 G337D probably damaging Het
Impact A T 18: 12,976,524 I92L probably benign Het
Ly6c2 A G 15: 75,111,596 probably null Het
Lypd6b G A 2: 49,947,456 V147I possibly damaging Het
Mdga2 T C 12: 66,723,120 D192G probably damaging Het
Mms22l T C 4: 24,586,344 probably null Het
Myo9a C T 9: 59,832,201 T732I possibly damaging Het
Myrf C T 19: 10,223,486 M274I probably benign Het
Nfx1 G A 4: 41,003,057 R686Q probably damaging Het
Olfr43 C T 11: 74,206,782 V145I probably benign Het
Olfr594 A T 7: 103,220,418 E233D probably benign Het
Oog4 T C 4: 143,438,011 T245A possibly damaging Het
Pclo A T 5: 14,540,055 K790* probably null Het
Pcm1 A G 8: 41,321,900 E1668G probably damaging Het
Pkhd1l1 T A 15: 44,591,964 N4040K probably damaging Het
Podnl1 T A 8: 84,129,276 S222T probably benign Het
Ppil4 A G 10: 7,799,632 T182A possibly damaging Het
Prdm13 T C 4: 21,678,544 K649E probably damaging Het
Prob1 A T 18: 35,653,610 H530Q probably benign Het
Rbbp4 A T 4: 129,317,649 M404K probably damaging Het
Rilpl1 A T 5: 124,493,837 F149I probably damaging Het
Sema6c T A 3: 95,171,216 S543T probably benign Het
Sh3rf3 G T 10: 59,007,082 W290L probably damaging Het
Slc2a12 T G 10: 22,665,451 S402A probably benign Het
Tas2r131 T A 6: 132,957,067 I260F possibly damaging Het
Tasp1 A G 2: 140,008,764 I113T possibly damaging Het
Tnrc18 G A 5: 142,773,859 R741* probably null Het
Ube2o G T 11: 116,546,464 D244E probably damaging Het
Vmn1r206 A T 13: 22,620,614 M141K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp747 A G 7: 127,374,588 S137P probably benign Het
Zfp951 A T 5: 104,815,285 H138Q possibly damaging Het
Other mutations in Ofcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Ofcc1 APN 13 40142804 missense probably damaging 0.97
IGL00489:Ofcc1 APN 13 40280491 missense probably damaging 1.00
IGL01952:Ofcc1 APN 13 40280861 missense probably damaging 1.00
IGL02126:Ofcc1 APN 13 40208775 missense probably benign
IGL02619:Ofcc1 APN 13 40097077 missense possibly damaging 0.68
IGL03069:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03133:Ofcc1 APN 13 40072768 missense probably benign 0.36
IGL03273:Ofcc1 APN 13 40180525 missense probably damaging 1.00
IGL03343:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03349:Ofcc1 APN 13 40072752 missense probably benign 0.13
IGL03399:Ofcc1 APN 13 40142838 missense possibly damaging 0.56
LCD18:Ofcc1 UTSW 13 40092967 intron probably benign
R0122:Ofcc1 UTSW 13 40280556 splice site probably null
R0320:Ofcc1 UTSW 13 40206696 missense probably benign 0.01
R0386:Ofcc1 UTSW 13 40214474 nonsense probably null
R0390:Ofcc1 UTSW 13 40015313 missense possibly damaging 0.85
R0829:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0866:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0945:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0981:Ofcc1 UTSW 13 40072698 missense probably damaging 1.00
R1055:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1186:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1187:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1400:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1411:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R1419:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1474:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1636:Ofcc1 UTSW 13 40180428 missense possibly damaging 0.86
R1691:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1886:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R1887:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R2176:Ofcc1 UTSW 13 40097119 missense probably benign
R2189:Ofcc1 UTSW 13 40180448 missense probably benign
R2242:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R2255:Ofcc1 UTSW 13 40094705 missense probably damaging 0.99
R2471:Ofcc1 UTSW 13 40097025 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40072760 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40087938 missense possibly damaging 0.56
R4366:Ofcc1 UTSW 13 40015461 missense probably benign 0.18
R4573:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4574:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4656:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4657:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4673:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4782:Ofcc1 UTSW 13 40001892 synonymous probably null
R4790:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4823:Ofcc1 UTSW 13 40280473 missense probably damaging 0.99
R4834:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4840:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4842:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4889:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4919:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4920:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4921:Ofcc1 UTSW 13 40214517 missense probably benign 0.10
R4948:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4953:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4961:Ofcc1 UTSW 13 40263559 critical splice donor site probably null
R5339:Ofcc1 UTSW 13 40087845 missense probably benign 0.35
R5512:Ofcc1 UTSW 13 40206810 missense probably benign 0.20
R5566:Ofcc1 UTSW 13 40094653 missense probably damaging 1.00
R5672:Ofcc1 UTSW 13 40280429 missense probably damaging 0.98
R5734:Ofcc1 UTSW 13 40087849 missense probably damaging 1.00
R5839:Ofcc1 UTSW 13 40280545 missense probably damaging 1.00
R5853:Ofcc1 UTSW 13 40206717 missense probably benign 0.00
R5896:Ofcc1 UTSW 13 40180584 missense probably benign 0.01
R5909:Ofcc1 UTSW 13 40263578 missense possibly damaging 0.92
R5995:Ofcc1 UTSW 13 40280422 missense probably damaging 1.00
R6306:Ofcc1 UTSW 13 40148576 missense probably benign
R6460:Ofcc1 UTSW 13 40287979 missense probably damaging 0.99
R6504:Ofcc1 UTSW 13 40097055 missense probably damaging 1.00
R6797:Ofcc1 UTSW 13 40087947 missense possibly damaging 0.75
R7091:Ofcc1 UTSW 13 40072767 missense probably damaging 0.99
R7098:Ofcc1 UTSW 13 40003966 critical splice donor site probably null
R7142:Ofcc1 UTSW 13 40004062 missense probably benign 0.00
R7240:Ofcc1 UTSW 13 40208841 missense probably benign
X0005:Ofcc1 UTSW 13 40142790 missense probably benign 0.01
X0005:Ofcc1 UTSW 13 40280532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACAGCCACACAATGGATGTCTT -3'
(R):5'- ACCATGTTTAATCATGAGCAGCACCT -3'

Sequencing Primer
(F):5'- CACACAATGGATGTCTTCATCTGAC -3'
(R):5'- TCTTTCTTTCTTCGTTG -3'
Posted On2014-01-05