Incidental Mutation 'R1061:Gli2'
ID94425
Institutional Source Beutler Lab
Gene Symbol Gli2
Ensembl Gene ENSMUSG00000048402
Gene NameGLI-Kruppel family member GLI2
Synonyms
MMRRC Submission 039147-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1061 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location118834132-119053619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118854517 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 160 (M160K)
Ref Sequence ENSEMBL: ENSMUSP00000124132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062483] [ENSMUST00000159839] [ENSMUST00000160991] [ENSMUST00000161056] [ENSMUST00000161301] [ENSMUST00000161451] [ENSMUST00000162552] [ENSMUST00000162607]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062483
AA Change: M325K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000054837
Gene: ENSMUSG00000048402
AA Change: M325K

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 259 278 N/A INTRINSIC
ZnF_C2H2 417 442 4.98e-1 SMART
ZnF_C2H2 450 477 6.57e0 SMART
ZnF_C2H2 483 507 2.09e-3 SMART
ZnF_C2H2 513 538 4.17e-3 SMART
ZnF_C2H2 544 569 1.84e-4 SMART
low complexity region 637 657 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1428 1435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159839
SMART Domains Protein: ENSMUSP00000125661
Gene: ENSMUSG00000048402

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160991
Predicted Effect probably benign
Transcript: ENSMUST00000161056
SMART Domains Protein: ENSMUSP00000124768
Gene: ENSMUSG00000048402

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161301
AA Change: M362K

PolyPhen 2 Score 0.593 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125342
Gene: ENSMUSG00000048402
AA Change: M362K

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 58 72 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161451
AA Change: M160K

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124132
Gene: ENSMUSG00000048402
AA Change: M160K

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162552
SMART Domains Protein: ENSMUSP00000125059
Gene: ENSMUSG00000048402

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162607
AA Change: M186K

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000123808
Gene: ENSMUSG00000048402
AA Change: M186K

DomainStartEndE-ValueType
low complexity region 120 139 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal malformations, absence of floorplate and foregut, lung and anorectal defects, and altered commissural neuron guidance. Most mutants die before embryonic day 18.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,277,809 A715T probably benign Het
Ampd2 A G 3: 108,075,689 Y641H probably damaging Het
Aqp4 A T 18: 15,398,191 V171E probably damaging Het
Arid4a T A 12: 71,074,955 S381R probably damaging Het
Armc8 T G 9: 99,537,731 N51H probably damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Bcl11a A T 11: 24,164,069 K471* probably null Het
Birc6 A G 17: 74,689,312 T4494A probably damaging Het
Btbd9 A G 17: 30,527,435 I139T probably benign Het
Ccdc114 T C 7: 45,941,755 I218T probably damaging Het
Ccdc60 C A 5: 116,172,468 R178S possibly damaging Het
Cd163 C T 6: 124,309,169 A226V probably benign Het
Cog1 T G 11: 113,652,037 S170A probably benign Het
Cwc15 T C 9: 14,507,915 L169P probably damaging Het
Cyp3a25 A T 5: 145,986,833 D333E probably benign Het
Ddc C T 11: 11,829,132 V331I probably benign Het
Dlc1 T A 8: 36,858,051 T367S probably benign Het
Dnah17 T C 11: 118,052,688 D3183G possibly damaging Het
Eif2a T A 3: 58,545,065 Y165* probably null Het
Eml6 T C 11: 29,777,267 D1285G probably damaging Het
Fam92b C A 8: 120,169,704 probably null Het
Fasn T C 11: 120,822,182 probably null Het
Fbn1 T C 2: 125,345,963 T1549A probably benign Het
Fezf2 T C 14: 12,342,713 Y384C probably damaging Het
Flvcr1 A T 1: 191,008,173 V550E probably benign Het
Gcm2 A G 13: 41,105,871 W41R probably damaging Het
Gpr61 C T 3: 108,150,307 R346H probably damaging Het
Hoxa5 A T 6: 52,204,155 S66T probably benign Het
Hsph1 A T 5: 149,618,418 V781D possibly damaging Het
Kdm3b G A 18: 34,796,862 V220M probably damaging Het
Klhl25 T A 7: 75,866,520 Y391* probably null Het
Mc2r A T 18: 68,407,809 Y138N probably damaging Het
Mtap C A 4: 89,156,584 D106E probably benign Het
Nup43 G T 10: 7,667,671 W37L probably damaging Het
Nxpe2 T A 9: 48,326,363 E197D probably damaging Het
Olfr1098 A T 2: 86,922,782 V250D possibly damaging Het
Olfr484 T C 7: 108,124,456 Y269C probably damaging Het
Olfr544 T A 7: 102,484,114 *335C probably null Het
Olfr934 C A 9: 38,982,483 C187F probably damaging Het
Pitrm1 A G 13: 6,555,575 H186R probably damaging Het
Pklr C T 3: 89,144,881 R467C probably damaging Het
Plxna2 A G 1: 194,644,093 N112D probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Ppp3cb A C 14: 20,508,614 probably null Het
R3hcc1l C T 19: 42,583,426 R135* probably null Het
Ralyl A C 3: 14,115,701 D68A probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
S100a1 T C 3: 90,511,312 N65S probably damaging Het
Scn11a A T 9: 119,795,663 M531K probably damaging Het
Slc5a5 T A 8: 70,890,221 M232L probably benign Het
Tet3 A T 6: 83,373,323 N1054K probably damaging Het
Tg A G 15: 66,698,559 N1427D probably benign Het
Tns1 A C 1: 73,917,672 V530G probably damaging Het
Trcg1 C A 9: 57,245,873 Q600K possibly damaging Het
Tshz3 A G 7: 36,768,706 E40G probably damaging Het
Usp34 T C 11: 23,384,420 F1138S possibly damaging Het
Vmn2r26 C T 6: 124,061,644 T726I probably benign Het
Vmn2r97 A T 17: 18,928,178 R112* probably null Het
Vwa2 G T 19: 56,908,994 R577L probably benign Het
Vwa3b A C 1: 37,157,430 Q46P probably damaging Het
Wdr25 T A 12: 108,992,799 probably null Het
Wrap53 A G 11: 69,562,400 L405P probably damaging Het
Zfp629 C A 7: 127,611,989 W216L probably damaging Het
Other mutations in Gli2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gli2 APN 1 118836891 missense probably benign
IGL01686:Gli2 APN 1 118848435 missense probably damaging 1.00
IGL01925:Gli2 APN 1 118853376 missense probably damaging 1.00
IGL02106:Gli2 APN 1 118836735 missense probably benign
IGL02202:Gli2 APN 1 118836866 missense probably damaging 0.96
IGL02255:Gli2 APN 1 118844349 critical splice donor site probably null
IGL02437:Gli2 APN 1 118836003 missense probably damaging 1.00
IGL02615:Gli2 APN 1 118844398 missense probably damaging 1.00
IGL02817:Gli2 APN 1 118836371 missense possibly damaging 0.55
IGL03294:Gli2 APN 1 118837436 missense probably benign
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0164:Gli2 UTSW 1 118890283 intron probably benign
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0308:Gli2 UTSW 1 118842062 missense probably benign 0.00
R0418:Gli2 UTSW 1 118840490 missense possibly damaging 0.93
R0558:Gli2 UTSW 1 118837649 missense probably benign 0.01
R0600:Gli2 UTSW 1 118840389 missense probably damaging 1.00
R0630:Gli2 UTSW 1 118841918 missense possibly damaging 0.52
R0690:Gli2 UTSW 1 118844460 missense probably damaging 1.00
R0942:Gli2 UTSW 1 118837506 missense probably damaging 1.00
R1104:Gli2 UTSW 1 118853350 missense probably damaging 1.00
R1141:Gli2 UTSW 1 118837937 missense possibly damaging 0.71
R1344:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1418:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1565:Gli2 UTSW 1 118841930 missense possibly damaging 0.57
R1605:Gli2 UTSW 1 118854560 missense probably damaging 1.00
R1640:Gli2 UTSW 1 118836524 missense possibly damaging 0.83
R1728:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1728:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1729:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1729:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1730:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1730:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1739:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1739:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1762:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1762:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1783:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1783:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1785:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1785:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1874:Gli2 UTSW 1 119002049 missense possibly damaging 0.83
R1969:Gli2 UTSW 1 118837700 missense probably benign 0.00
R2199:Gli2 UTSW 1 118837648 missense possibly damaging 0.95
R2377:Gli2 UTSW 1 118837125 missense possibly damaging 0.90
R2883:Gli2 UTSW 1 118868144 missense probably damaging 0.97
R2924:Gli2 UTSW 1 118836359 missense probably benign 0.00
R4363:Gli2 UTSW 1 118853370 missense probably benign 0.00
R4430:Gli2 UTSW 1 118837244 missense probably benign
R4463:Gli2 UTSW 1 118836008 missense probably damaging 1.00
R4583:Gli2 UTSW 1 118842068 missense probably benign
R4613:Gli2 UTSW 1 118837511 missense probably damaging 1.00
R4674:Gli2 UTSW 1 118836029 missense probably damaging 1.00
R4735:Gli2 UTSW 1 118840322 missense probably damaging 1.00
R4770:Gli2 UTSW 1 118982588 intron probably benign
R4936:Gli2 UTSW 1 118836140 missense probably benign
R5137:Gli2 UTSW 1 118855503 missense probably damaging 1.00
R5228:Gli2 UTSW 1 118836206 missense probably damaging 1.00
R5318:Gli2 UTSW 1 118844470 missense probably damaging 1.00
R5619:Gli2 UTSW 1 118836755 missense probably benign 0.27
R5661:Gli2 UTSW 1 118853302 nonsense probably null
R6005:Gli2 UTSW 1 118842064 missense probably damaging 1.00
R6012:Gli2 UTSW 1 118837715 missense probably damaging 0.99
R6341:Gli2 UTSW 1 118836224 missense probably damaging 1.00
R6357:Gli2 UTSW 1 118841959 missense probably damaging 1.00
R6425:Gli2 UTSW 1 118835894 nonsense probably null
R6513:Gli2 UTSW 1 118855554 missense probably damaging 1.00
R6802:Gli2 UTSW 1 118842065 missense probably damaging 1.00
R6889:Gli2 UTSW 1 118844416 missense probably damaging 1.00
X0028:Gli2 UTSW 1 118837277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCAGTCAGGCTAAAGTGCAGAG -3'
(R):5'- GATCAGCAAGGCTAAGGACATCCG -3'

Sequencing Primer
(F):5'- GAGATCTCTACCAGTTCCTAGC -3'
(R):5'- AGGCTAAGGACATCCGTTTGC -3'
Posted On2014-01-05