Incidental Mutation 'R1133:Ttc30a2'
ID94513
Institutional Source Beutler Lab
Gene Symbol Ttc30a2
Ensembl Gene ENSMUSG00000075272
Gene Nametetratricopeptide repeat domain 30A2
SynonymsOTTMUSG00000015167
MMRRC Submission 039206-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1133 (G1)
Quality Score191
Status Not validated
Chromosome2
Chromosomal Location75975740-75978170 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 75977383 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 262 (Q262*)
Ref Sequence ENSEMBL: ENSMUSP00000097575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099994] [ENSMUST00000099995]
Predicted Effect probably benign
Transcript: ENSMUST00000099994
SMART Domains Protein: ENSMUSP00000097574
Gene: ENSMUSG00000075271

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.19e1 SMART
TPR 187 220 6.24e1 SMART
coiled coil region 380 411 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099995
AA Change: Q262*
SMART Domains Protein: ENSMUSP00000097575
Gene: ENSMUSG00000075272
AA Change: Q262*

DomainStartEndE-ValueType
TPR 45 78 1.1e-1 SMART
TPR 153 186 2.77e1 SMART
Blast:TPR 187 224 1e-13 BLAST
coiled coil region 380 405 N/A INTRINSIC
TPR 423 456 2.24e1 SMART
Blast:TPR 457 491 1e-10 BLAST
low complexity region 514 528 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahr A G 12: 35,526,806 L42P probably damaging Het
B430305J03Rik C T 3: 61,364,009 W105* probably null Het
Gpr156 T A 16: 38,005,321 N633K probably benign Het
Hook2 T C 8: 84,995,804 L324P probably damaging Het
Olfr147 A T 9: 38,403,731 M283L probably benign Het
Socs4 A G 14: 47,290,194 I195M probably benign Het
Syne1 A G 10: 5,349,044 I1014T possibly damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Other mutations in Ttc30a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Ttc30a2 APN 2 75976338 missense probably benign 0.16
IGL03269:Ttc30a2 APN 2 75978135 missense possibly damaging 0.50
R0011:Ttc30a2 UTSW 2 75976217 missense probably damaging 1.00
R0751:Ttc30a2 UTSW 2 75978031 missense probably damaging 0.99
R0766:Ttc30a2 UTSW 2 75976332 missense probably benign 0.00
R0835:Ttc30a2 UTSW 2 75978150 missense probably benign
R1212:Ttc30a2 UTSW 2 75976479 missense probably damaging 1.00
R1312:Ttc30a2 UTSW 2 75976332 missense probably benign 0.00
R4780:Ttc30a2 UTSW 2 75977576 missense probably benign 0.19
R4799:Ttc30a2 UTSW 2 75977385 missense probably benign 0.01
R4847:Ttc30a2 UTSW 2 75977714 missense probably benign 0.03
R5176:Ttc30a2 UTSW 2 75977077 missense probably benign
R5390:Ttc30a2 UTSW 2 75977286 missense probably damaging 1.00
R5724:Ttc30a2 UTSW 2 75977730 missense probably benign
R6975:Ttc30a2 UTSW 2 75976408 missense probably damaging 1.00
R6975:Ttc30a2 UTSW 2 75977660 nonsense probably null
R7028:Ttc30a2 UTSW 2 75976269 nonsense probably null
R7234:Ttc30a2 UTSW 2 75976196 nonsense probably null
R7246:Ttc30a2 UTSW 2 75977679 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGCATTTTCTGCCAGGACATC -3'
(R):5'- TCATTGAGCGTGGCATCCGTCAAC -3'

Sequencing Primer
(F):5'- AGCAGGTTGCCAAAGGTCTC -3'
(R):5'- ACACCCAGAACTCGGTGTG -3'
Posted On2014-01-05