Incidental Mutation 'R1133:Ahr'
ID 94545
Institutional Source Beutler Lab
Gene Symbol Ahr
Ensembl Gene ENSMUSG00000019256
Gene Name aryl-hydrocarbon receptor
Synonyms In, bHLHe76, dioxin receptor, Ah, Ahh, Ahre
MMRRC Submission 039206-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.954) question?
Stock # R1133 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 35547978-35584988 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35576805 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 42 (L42P)
Ref Sequence ENSEMBL: ENSMUSP00000112137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110811] [ENSMUST00000116436]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000110811
AA Change: L42P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106434
Gene: ENSMUSG00000019256
AA Change: L42P

DomainStartEndE-ValueType
HLH 33 87 3.31e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116436
AA Change: L42P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112137
Gene: ENSMUSG00000019256
AA Change: L42P

DomainStartEndE-ValueType
HLH 33 87 5.09e-7 SMART
PAS 111 177 2.72e-12 SMART
low complexity region 212 222 N/A INTRINSIC
PAS 266 336 1.77e-2 SMART
PAC 342 383 2.39e-8 SMART
low complexity region 606 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173414
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a ligand-activated helix-loop-helix transcription factor involved in the regulation of biological responses to planar aromatic hydrocarbons. This receptor has been shown to regulate xenobiotic-metabolizing enzymes such as cytochrome P450. Before ligand binding, the encoded protein is sequestered in the cytoplasm; upon ligand binding, this protein moves to the nucleus and stimulates transcription of target genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for null or hypomorphic alleles do not respond to cyclic compounds (e.g., dioxin) and are resistant to their teratogenic effects. Depending on the allele, null mutants may also have liver defects, impaired female fertility, neonatal or postnatal lethality, and spleen abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(2) Targeted, other(6) Other(4)
Other mutations in this stock
Total: 8 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
B430305J03Rik C T 3: 61,271,430 (GRCm39) W105* probably null Het
Gpr156 T A 16: 37,825,683 (GRCm39) N633K probably benign Het
Hook2 T C 8: 85,722,433 (GRCm39) L324P probably damaging Het
Ift70a2 G A 2: 75,807,727 (GRCm39) Q262* probably null Het
Or8b3 A T 9: 38,315,027 (GRCm39) M283L probably benign Het
Socs4 A G 14: 47,527,651 (GRCm39) I195M probably benign Het
Syne1 A G 10: 5,299,044 (GRCm39) I1014T possibly damaging Het
Ugt2b38 T G 5: 87,560,232 (GRCm39) N361H probably damaging Het
Other mutations in Ahr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Ahr APN 12 35,554,096 (GRCm39) nonsense probably null
IGL01336:Ahr APN 12 35,553,839 (GRCm39) missense probably benign 0.19
IGL01972:Ahr APN 12 35,554,448 (GRCm39) missense possibly damaging 0.89
IGL02117:Ahr APN 12 35,562,922 (GRCm39) nonsense probably null
IGL03028:Ahr APN 12 35,554,709 (GRCm39) missense probably benign
IGL03110:Ahr APN 12 35,554,970 (GRCm39) missense probably damaging 0.98
IGL03394:Ahr APN 12 35,553,751 (GRCm39) nonsense probably null
IGL03403:Ahr APN 12 35,554,325 (GRCm39) missense possibly damaging 0.63
BB002:Ahr UTSW 12 35,565,067 (GRCm39) nonsense probably null
BB012:Ahr UTSW 12 35,565,067 (GRCm39) nonsense probably null
R0620:Ahr UTSW 12 35,558,193 (GRCm39) missense probably benign 0.26
R0784:Ahr UTSW 12 35,558,141 (GRCm39) missense possibly damaging 0.79
R1168:Ahr UTSW 12 35,554,531 (GRCm39) missense possibly damaging 0.49
R4678:Ahr UTSW 12 35,557,463 (GRCm39) missense probably damaging 1.00
R5615:Ahr UTSW 12 35,553,884 (GRCm39) missense probably benign 0.01
R6066:Ahr UTSW 12 35,554,920 (GRCm39) missense probably damaging 0.99
R6466:Ahr UTSW 12 35,554,031 (GRCm39) missense probably benign 0.29
R7369:Ahr UTSW 12 35,554,659 (GRCm39) missense possibly damaging 0.94
R7382:Ahr UTSW 12 35,554,514 (GRCm39) missense probably damaging 1.00
R7685:Ahr UTSW 12 35,554,016 (GRCm39) missense probably damaging 0.96
R7819:Ahr UTSW 12 35,559,999 (GRCm39) missense probably damaging 1.00
R7897:Ahr UTSW 12 35,554,169 (GRCm39) missense possibly damaging 0.47
R7925:Ahr UTSW 12 35,565,067 (GRCm39) nonsense probably null
R8179:Ahr UTSW 12 35,560,050 (GRCm39) missense probably benign 0.01
R8274:Ahr UTSW 12 35,560,068 (GRCm39) missense probably benign
R8342:Ahr UTSW 12 35,558,271 (GRCm39) missense probably damaging 1.00
R8985:Ahr UTSW 12 35,576,736 (GRCm39) missense possibly damaging 0.91
R9069:Ahr UTSW 12 35,562,771 (GRCm39) intron probably benign
R9114:Ahr UTSW 12 35,561,164 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACCATCCAAACAGCTCCATTGTC -3'
(R):5'- ATGTTTCGTCGGTAGAGCAGTCCC -3'

Sequencing Primer
(F):5'- GTCTTGTCACCAACATTTAAAGGACC -3'
(R):5'- GGTAGAGCAGTCCCTGAGG -3'
Posted On 2014-01-05