Incidental Mutation 'R1023:Zfp335'
ID94591
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 164892585 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 1254 (H1254Y)
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041361
AA Change: H1254Y

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: H1254Y

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041643
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Meta Mutation Damage Score 0.258 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
PIT4403001:Zfp335 UTSW 2 164893716 missense possibly damaging 0.56
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATCCGGTCCATACCTGTGACAGC -3'
(R):5'- AGACAGTACAGCATCTGGTGACCTC -3'

Sequencing Primer
(F):5'- CATACCTGTGACAGCGGAGTG -3'
(R):5'- TGAGGCCATTGTCCATAGC -3'
Posted On2014-01-05