Incidental Mutation 'R1023:Ubap2l'
ID94594
Institutional Source Beutler Lab
Gene Symbol Ubap2l
Ensembl Gene ENSMUSG00000042520
Gene Nameubiquitin-associated protein 2-like
SynonymsA430103N23Rik, NICE-4, 3110083O19Rik, 4932431F02Rik
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location90000140-90052628 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to G at 90047873 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029552] [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000068798] [ENSMUST00000090908] [ENSMUST00000159064] [ENSMUST00000160640] [ENSMUST00000161918] [ENSMUST00000162114] [ENSMUST00000195995] [ENSMUST00000196633] [ENSMUST00000196843] [ENSMUST00000196917] [ENSMUST00000197903] [ENSMUST00000198322] [ENSMUST00000199834] [ENSMUST00000199929]
Predicted Effect probably benign
Transcript: ENSMUST00000029552
SMART Domains Protein: ENSMUSP00000029552
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 1.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068798
SMART Domains Protein: ENSMUSP00000066840
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 171 2.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090908
SMART Domains Protein: ENSMUSP00000088424
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159064
SMART Domains Protein: ENSMUSP00000124554
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 6 188 4.2e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159202
SMART Domains Protein: ENSMUSP00000123777
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 61 2.3e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160640
SMART Domains Protein: ENSMUSP00000124028
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 3.2e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161918
SMART Domains Protein: ENSMUSP00000123740
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 64 2.2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162114
SMART Domains Protein: ENSMUSP00000124822
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 1.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162595
Predicted Effect probably benign
Transcript: ENSMUST00000195995
SMART Domains Protein: ENSMUSP00000143638
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 526 557 3.7e-18 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196568
Predicted Effect probably benign
Transcript: ENSMUST00000196633
SMART Domains Protein: ENSMUSP00000143423
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 6.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196917
SMART Domains Protein: ENSMUSP00000142602
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 50 2e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000197903
SMART Domains Protein: ENSMUSP00000143519
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 81 7e-32 PDB
Blast:UBA 50 81 7e-16 BLAST
SCOP:d1efub3 51 81 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198282
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199834
SMART Domains Protein: ENSMUSP00000143254
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199929
SMART Domains Protein: ENSMUSP00000142488
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 57 2e-12 PDB
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased female body size and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Ubap2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2l APN 3 90009256 nonsense probably null
IGL02606:Ubap2l APN 3 90038428 missense probably damaging 0.98
IGL02809:Ubap2l APN 3 90021246 missense probably damaging 1.00
panhandle UTSW 3 90031376 splice site probably benign
plainview UTSW 3 90038850 missense probably damaging 1.00
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0052:Ubap2l UTSW 3 90038928 missense possibly damaging 0.93
R0128:Ubap2l UTSW 3 90021373 missense possibly damaging 0.89
R0130:Ubap2l UTSW 3 90021373 missense possibly damaging 0.89
R0502:Ubap2l UTSW 3 90009213 missense probably damaging 1.00
R0619:Ubap2l UTSW 3 90017220 missense probably benign 0.01
R0726:Ubap2l UTSW 3 90021246 missense probably damaging 1.00
R1172:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1174:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1175:Ubap2l UTSW 3 90023500 missense probably benign 0.24
R1191:Ubap2l UTSW 3 90023575 missense probably damaging 1.00
R1432:Ubap2l UTSW 3 90019328 missense probably benign 0.11
R1582:Ubap2l UTSW 3 90034671 missense probably damaging 1.00
R1771:Ubap2l UTSW 3 90019231 missense probably damaging 1.00
R2058:Ubap2l UTSW 3 90031376 splice site probably benign
R2059:Ubap2l UTSW 3 90031376 splice site probably benign
R2081:Ubap2l UTSW 3 90038964 missense possibly damaging 0.92
R2408:Ubap2l UTSW 3 90009132 missense probably null 0.99
R3404:Ubap2l UTSW 3 90038850 missense probably damaging 1.00
R3551:Ubap2l UTSW 3 90015451 missense unknown
R4132:Ubap2l UTSW 3 90009184 missense probably damaging 1.00
R4782:Ubap2l UTSW 3 90020903 missense probably damaging 0.98
R4798:Ubap2l UTSW 3 90020903 missense probably damaging 0.98
R5173:Ubap2l UTSW 3 90021030 missense possibly damaging 0.86
R5274:Ubap2l UTSW 3 90012730 missense probably damaging 1.00
R5387:Ubap2l UTSW 3 90006596 missense probably benign 0.10
R6548:Ubap2l UTSW 3 90023560 missense probably damaging 1.00
R6912:Ubap2l UTSW 3 90038848 missense possibly damaging 0.84
R6995:Ubap2l UTSW 3 90009241 missense probably damaging 0.98
R7039:Ubap2l UTSW 3 90002355 missense probably damaging 1.00
R7323:Ubap2l UTSW 3 90015406 missense unknown
Predicted Primers PCR Primer
(F):5'- TGATGCTACACTGCATGGAAACCAC -3'
(R):5'- AGTATGTTTGAGGCCAGCTCACAC -3'

Sequencing Primer
(F):5'- CCACTATCAGGTGGTATAGTTACTC -3'
(R):5'- agtttgatccccagcacc -3'
Posted On2014-01-05