Incidental Mutation 'R1023:1110002E22Rik'
List |< first << previous [record 96 of 386652] next >> last >|
ID94598
Institutional Source Beutler Lab
Gene Symbol 1110002E22Rik
Ensembl Gene ENSMUSG00000090066
Gene NameRIKEN cDNA 1110002E22 gene
Synonyms
MMRRC Submission 039125-MU
Accession Numbers
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location138065052-138081506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 138066871 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 607 (A607V)
Ref Sequence ENSEMBL: ENSMUSP00000123851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163080]
Predicted Effect probably damaging
Transcript: ENSMUST00000163080
AA Change: A607V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123851
Gene: ENSMUSG00000090066
AA Change: A607V

DomainStartEndE-ValueType
low complexity region 44 55 N/A INTRINSIC
low complexity region 87 102 N/A INTRINSIC
low complexity region 229 247 N/A INTRINSIC
low complexity region 422 438 N/A INTRINSIC
low complexity region 459 505 N/A INTRINSIC
low complexity region 667 680 N/A INTRINSIC
low complexity region 937 948 N/A INTRINSIC
low complexity region 995 1007 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
low complexity region 1224 1242 N/A INTRINSIC
low complexity region 1376 1385 N/A INTRINSIC
Pfam:DUF4585 1598 1667 6.9e-32 PFAM
low complexity region 1723 1738 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562F07Rik A G 1: 160,077,487 S45P unknown Het
Ap3d1 A T 10: 80,714,258 L713Q probably null Het
Baz2a A G 10: 128,121,807 T1008A probably benign Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 W144* probably null Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q370R possibly damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 unknown Homo
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2455P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Mfi2 T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1608I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1058P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in 1110002E22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0026:1110002E22Rik UTSW 3 138066805 missense possibly damaging 0.95
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0047:1110002E22Rik UTSW 3 138066264 missense probably damaging 0.97
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0102:1110002E22Rik UTSW 3 138068113 missense probably damaging 1.00
R0197:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0239:1110002E22Rik UTSW 3 138065834 small deletion unknown
R0394:1110002E22Rik UTSW 3 138067304 missense probably damaging 0.99
R0401:1110002E22Rik UTSW 3 138070306 missense possibly damaging 0.73
R0496:1110002E22Rik UTSW 3 138068244 missense probably damaging 1.00
R0591:1110002E22Rik UTSW 3 138068943 nonsense probably null
R0711:1110002E22Rik UTSW 3 138068225 missense probably damaging 0.99
R0883:1110002E22Rik UTSW 3 138069871 missense probably damaging 1.00
R0908:1110002E22Rik UTSW 3 138070077 missense probably damaging 0.99
R0968:1110002E22Rik UTSW 3 138067206 missense probably damaging 0.99
R1168:1110002E22Rik UTSW 3 138067900 missense probably benign 0.20
R1472:1110002E22Rik UTSW 3 138067552 missense possibly damaging 0.95
R1538:1110002E22Rik UTSW 3 138065401 missense probably benign 0.02
R1648:1110002E22Rik UTSW 3 138069420 missense probably benign 0.18
R1800:1110002E22Rik UTSW 3 138066718 missense probably damaging 1.00
R1919:1110002E22Rik UTSW 3 138067270 missense probably damaging 0.99
R1974:1110002E22Rik UTSW 3 138067267 missense probably damaging 1.00
R1990:1110002E22Rik UTSW 3 138065658 nonsense probably null
R1991:1110002E22Rik UTSW 3 138065658 nonsense probably null
R2102:1110002E22Rik UTSW 3 138065173 missense probably damaging 0.99
R2761:1110002E22Rik UTSW 3 138067780 missense probably damaging 0.99
R2899:1110002E22Rik UTSW 3 138065682 missense probably benign 0.00
R3618:1110002E22Rik UTSW 3 138068407 missense probably damaging 1.00
R3904:1110002E22Rik UTSW 3 138066639 missense probably benign 0.15
R3955:1110002E22Rik UTSW 3 138068073 missense probably benign 0.00
R4520:1110002E22Rik UTSW 3 138070266 missense probably damaging 0.99
R4619:1110002E22Rik UTSW 3 138069759 missense probably damaging 0.99
R4736:1110002E22Rik UTSW 3 138068485 missense probably damaging 0.99
R4752:1110002E22Rik UTSW 3 138069990 missense possibly damaging 0.91
R4777:1110002E22Rik UTSW 3 138065742 missense probably benign 0.09
R4780:1110002E22Rik UTSW 3 138065370 missense probably benign 0.02
R4824:1110002E22Rik UTSW 3 138065676 missense probably benign 0.00
R4829:1110002E22Rik UTSW 3 138069019 missense probably damaging 0.99
R4965:1110002E22Rik UTSW 3 138069672 missense probably benign
R5206:1110002E22Rik UTSW 3 138066511 missense probably benign 0.00
R5212:1110002E22Rik UTSW 3 138065850 missense possibly damaging 0.85
R5373:1110002E22Rik UTSW 3 138067635 missense probably benign
R5374:1110002E22Rik UTSW 3 138067635 missense probably benign
R5506:1110002E22Rik UTSW 3 138067947 missense probably damaging 1.00
R5528:1110002E22Rik UTSW 3 138066499 missense probably benign
R5536:1110002E22Rik UTSW 3 138066388 missense possibly damaging 0.89
R5587:1110002E22Rik UTSW 3 138065409 missense probably benign
R5759:1110002E22Rik UTSW 3 138068658 missense probably benign
R5933:1110002E22Rik UTSW 3 138070348 missense probably damaging 1.00
R5957:1110002E22Rik UTSW 3 138070161 missense probably benign
R6092:1110002E22Rik UTSW 3 138068940 missense not run
X0003:1110002E22Rik UTSW 3 138069096 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCTGCCAAGCATGAAGGCGAC -3'
(R):5'- AGAGCCAGTTTGGACCTGCTTCTG -3'

Sequencing Primer
(F):5'- ACATGAGCCTCCGAGTCTC -3'
(R):5'- TTTGCTGACCACAAACTCCAAG -3'
Posted OnJan 05, 2014