Incidental Mutation 'R1131:Ddias'
ID94620
Institutional Source Beutler Lab
Gene Symbol Ddias
Ensembl Gene ENSMUSG00000030641
Gene NameDNA damage-induced apoptosis suppressor
Synonymsnoxin, 4632434I11Rik
MMRRC Submission 039204-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1131 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location92857525-92874247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92859886 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 274 (S274T)
Ref Sequence ENSEMBL: ENSMUSP00000032877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032877] [ENSMUST00000208356] [ENSMUST00000209074]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032877
AA Change: S274T

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032877
Gene: ENSMUSG00000030641
AA Change: S274T

DomainStartEndE-ValueType
Pfam:Rep_fac-A_C 7 118 2.1e-14 PFAM
low complexity region 197 209 N/A INTRINSIC
low complexity region 242 253 N/A INTRINSIC
low complexity region 727 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208356
Predicted Effect probably benign
Transcript: ENSMUST00000209074
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503B20Rik G T 3: 146,651,082 H24N probably damaging Het
Ano7 T C 1: 93,401,776 F723L probably benign Het
Clec9a T G 6: 129,410,315 C44W probably damaging Het
Commd7 T A 2: 153,622,127 Q44L probably benign Het
Fnip1 A T 11: 54,493,303 E342V possibly damaging Het
Gata4 A G 14: 63,204,740 F210S possibly damaging Het
Ggt6 A G 11: 72,435,680 E21G possibly damaging Het
Gzf1 A G 2: 148,690,867 N647S probably benign Het
Hnrnpk T C 13: 58,394,165 probably null Het
Lgr6 G A 1: 134,987,304 R569W probably damaging Het
Mug1 T A 6: 121,861,185 I458N probably benign Het
Mzf1 C A 7: 13,052,771 R124L possibly damaging Het
Olfr559 C A 7: 102,723,680 R270L probably damaging Het
Spta1 T A 1: 174,185,647 S375T probably damaging Het
Tanc2 G A 11: 105,835,002 E331K probably damaging Het
Tcirg1 A G 19: 3,896,301 S799P probably damaging Het
Tnrc18 T A 5: 142,787,208 D439V unknown Het
Tnrc6b A T 15: 80,894,453 Q1209L possibly damaging Het
Trim24 T A 6: 37,957,782 C811S probably damaging Het
Ttc7b A T 12: 100,382,119 probably null Het
Vmn1r42 A T 6: 89,845,569 F6Y possibly damaging Het
Other mutations in Ddias
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02727:Ddias APN 7 92866622 missense probably damaging 0.98
IGL02820:Ddias APN 7 92859343 missense probably benign 0.07
I0000:Ddias UTSW 7 92866640 missense possibly damaging 0.69
R0094:Ddias UTSW 7 92859900 missense possibly damaging 0.61
R0482:Ddias UTSW 7 92859528 missense probably benign 0.41
R0883:Ddias UTSW 7 92859337 missense probably benign
R1722:Ddias UTSW 7 92860042 missense possibly damaging 0.63
R1758:Ddias UTSW 7 92859363 missense probably benign 0.03
R1937:Ddias UTSW 7 92858622 missense probably benign 0.07
R2067:Ddias UTSW 7 92859699 missense possibly damaging 0.79
R2124:Ddias UTSW 7 92858256 missense probably benign 0.00
R2483:Ddias UTSW 7 92859592 missense probably benign 0.13
R3623:Ddias UTSW 7 92859592 missense probably benign 0.13
R3690:Ddias UTSW 7 92860158 missense probably benign 0.24
R4015:Ddias UTSW 7 92859861 missense probably benign 0.06
R4021:Ddias UTSW 7 92861478 missense possibly damaging 0.57
R4022:Ddias UTSW 7 92861478 missense possibly damaging 0.57
R4384:Ddias UTSW 7 92858223 missense probably damaging 0.98
R4410:Ddias UTSW 7 92858079 missense probably benign 0.04
R4691:Ddias UTSW 7 92858816 missense probably damaging 0.99
R5653:Ddias UTSW 7 92858729 missense probably damaging 1.00
R6666:Ddias UTSW 7 92858081 missense probably benign
R6853:Ddias UTSW 7 92859565 missense possibly damaging 0.46
X0027:Ddias UTSW 7 92858995 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCAACTGTTGCAAACTGGACTC -3'
(R):5'- TTCTGCCTAGCCCACATGTTAAAGG -3'

Sequencing Primer
(F):5'- ACTGGACTCGGTAAGCCTAATTC -3'
(R):5'- ACTTCAGATGACTCAGACAGTG -3'
Posted On2014-01-05