Incidental Mutation 'R1023:Dqx1'
ID94623
Institutional Source Beutler Lab
Gene Symbol Dqx1
Ensembl Gene ENSMUSG00000009145
Gene NameDEAQ RNA-dependent ATPase
Synonyms
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83057844-83067318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 83061089 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 486 (C486Y)
Ref Sequence ENSEMBL: ENSMUSP00000076708 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077502] [ENSMUST00000092618] [ENSMUST00000204803]
Predicted Effect probably damaging
Transcript: ENSMUST00000077502
AA Change: C486Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076708
Gene: ENSMUSG00000009145
AA Change: C486Y

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 5.01e-4 SMART
low complexity region 268 280 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
HA2 441 530 4e-19 SMART
Pfam:OB_NTP_bind 555 674 2.2e-11 PFAM
low complexity region 695 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092618
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203749
Predicted Effect probably benign
Transcript: ENSMUST00000203915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect probably benign
Transcript: ENSMUST00000204343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204510
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204752
Predicted Effect probably benign
Transcript: ENSMUST00000204803
SMART Domains Protein: ENSMUSP00000144697
Gene: ENSMUSG00000009145

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 2.1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Meta Mutation Damage Score 0.65 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Ubtf T C 11: 102,311,450 E197G possibly damaging Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Dqx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Dqx1 APN 6 83066427 unclassified probably benign
IGL02158:Dqx1 APN 6 83058910 splice site probably benign
IGL02288:Dqx1 APN 6 83060328 missense probably damaging 0.98
IGL02801:Dqx1 APN 6 83060495 unclassified probably null
IGL02929:Dqx1 APN 6 83060484 unclassified probably benign
R0396:Dqx1 UTSW 6 83059005 missense probably benign 0.00
R0448:Dqx1 UTSW 6 83060345 missense probably damaging 1.00
R0471:Dqx1 UTSW 6 83059426 splice site probably benign
R1022:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1024:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1480:Dqx1 UTSW 6 83059452 missense possibly damaging 0.61
R1804:Dqx1 UTSW 6 83060322 missense probably damaging 1.00
R1848:Dqx1 UTSW 6 83066107 missense probably damaging 1.00
R1982:Dqx1 UTSW 6 83058577 missense probably damaging 1.00
R2064:Dqx1 UTSW 6 83058543 unclassified probably benign
R2350:Dqx1 UTSW 6 83059087 nonsense probably null
R3110:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3112:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3119:Dqx1 UTSW 6 83066235 nonsense probably null
R4179:Dqx1 UTSW 6 83059479 missense probably benign 0.03
R4180:Dqx1 UTSW 6 83059479 missense probably benign 0.03
R4873:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4875:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4882:Dqx1 UTSW 6 83066088 critical splice acceptor site probably null
R5015:Dqx1 UTSW 6 83066111 missense probably benign 0.00
R5128:Dqx1 UTSW 6 83060567 missense probably damaging 0.96
R5346:Dqx1 UTSW 6 83059719 missense possibly damaging 0.87
R5480:Dqx1 UTSW 6 83064803 missense probably damaging 0.98
R6939:Dqx1 UTSW 6 83059465 missense probably damaging 0.99
R6979:Dqx1 UTSW 6 83061011 missense probably damaging 1.00
R7059:Dqx1 UTSW 6 83064809 missense probably benign 0.18
R7084:Dqx1 UTSW 6 83066455 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTAAGCCCTGTGTCCTCACCAG -3'
(R):5'- AGTCAGCAATGTGGGCGAGATTC -3'

Sequencing Primer
(F):5'- AGCACCAGAAGCACTGATG -3'
(R):5'- ATGGGCAGACACTTGGTTCC -3'
Posted On2014-01-05