Incidental Mutation 'R1023:Cdh15'
ID 94634
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Name cadherin 15
Synonyms M cadherin, Mcad, Cdh14
MMRRC Submission 039125-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1023 (G1)
Quality Score 157
Status Validated
Chromosome 8
Chromosomal Location 123575113-123594136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123591939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 608 (I608T)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
AlphaFold P33146
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: I608T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: I608T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211940
Meta Mutation Damage Score 0.1516 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,772,632 (GRCm39) A607V probably damaging Het
4930523C07Rik A G 1: 159,905,057 (GRCm39) probably benign Het
Ap3d1 A T 10: 80,550,092 (GRCm39) L713Q probably damaging Het
Baz2a A G 10: 127,957,676 (GRCm39) T1010A possibly damaging Het
Cdkl2 A T 5: 92,187,145 (GRCm39) D40E possibly damaging Het
Col9a2 G A 4: 120,901,207 (GRCm39) G118R unknown Het
Cryge C A 1: 65,089,945 (GRCm39) C79F probably damaging Het
Dapk1 T C 13: 60,878,799 (GRCm39) L596P probably damaging Het
Dqx1 G A 6: 83,038,070 (GRCm39) C486Y probably damaging Het
Dync2i1 T C 12: 116,196,277 (GRCm39) E490G probably damaging Het
Enam A G 5: 88,649,826 (GRCm39) Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably benign Het
Gnpat A T 8: 125,597,519 (GRCm39) D27V probably benign Het
Htr5a A T 5: 28,047,996 (GRCm39) T184S possibly damaging Het
Lap3 C T 5: 45,652,553 (GRCm39) P50S probably benign Het
Mamdc2 A T 19: 23,288,271 (GRCm39) M589K probably damaging Het
Mast4 A G 13: 102,872,004 (GRCm39) S2263P probably benign Het
Mef2b C T 8: 70,618,247 (GRCm39) P109L possibly damaging Het
Meltf T A 16: 31,703,778 (GRCm39) F168L probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Nup205 T A 6: 35,211,641 (GRCm39) F1661I probably damaging Het
Or11h4b A T 14: 50,918,473 (GRCm39) L206H probably damaging Het
Or5h19 A T 16: 58,856,178 (GRCm39) N307K probably benign Het
Plac8 A T 5: 100,704,447 (GRCm39) D83E probably benign Het
Pnpt1 T C 11: 29,091,328 (GRCm39) probably benign Het
Pold2 G T 11: 5,825,140 (GRCm39) Q86K probably benign Het
Ptprt A G 2: 161,400,863 (GRCm39) L1057P probably damaging Het
Rev3l A G 10: 39,708,635 (GRCm39) H2284R probably damaging Het
Scart1 T A 7: 139,804,376 (GRCm39) C484S possibly damaging Het
Skint6 A C 4: 113,095,300 (GRCm39) S120A probably benign Het
Slc1a7 G A 4: 107,864,770 (GRCm39) V270M probably damaging Het
Spata2 A G 2: 167,327,142 (GRCm39) M85T probably benign Het
Taf1b G T 12: 24,559,558 (GRCm39) probably benign Het
Tert A G 13: 73,790,178 (GRCm39) N844S probably benign Het
Thrap3 G A 4: 126,073,882 (GRCm39) S288L possibly damaging Het
Ubap2l A G 3: 89,955,180 (GRCm39) probably benign Het
Ubtf T C 11: 102,202,276 (GRCm39) E197G possibly damaging Het
Usp20 G T 2: 30,897,825 (GRCm39) G216W probably damaging Het
Yy1 T A 12: 108,759,457 (GRCm39) V40E unknown Het
Zfp335 G A 2: 164,734,505 (GRCm39) H1254Y possibly damaging Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 123,592,062 (GRCm39) intron probably benign
IGL01958:Cdh15 APN 8 123,586,089 (GRCm39) missense probably damaging 1.00
IGL02588:Cdh15 APN 8 123,583,291 (GRCm39) nonsense probably null
IGL02793:Cdh15 APN 8 123,587,721 (GRCm39) missense probably damaging 1.00
IGL02947:Cdh15 APN 8 123,592,111 (GRCm39) missense probably benign 0.00
R0310:Cdh15 UTSW 8 123,592,175 (GRCm39) missense probably damaging 1.00
R0441:Cdh15 UTSW 8 123,587,705 (GRCm39) missense probably damaging 1.00
R0766:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R0898:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1054:Cdh15 UTSW 8 123,591,076 (GRCm39) missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R1081:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1101:Cdh15 UTSW 8 123,587,585 (GRCm39) missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1209:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1210:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1312:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R1317:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1318:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1393:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1428:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1429:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1695:Cdh15 UTSW 8 123,588,755 (GRCm39) missense probably benign 0.05
R2157:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2170:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2178:Cdh15 UTSW 8 123,591,715 (GRCm39) splice site probably null
R2252:Cdh15 UTSW 8 123,584,161 (GRCm39) missense probably damaging 1.00
R2290:Cdh15 UTSW 8 123,586,056 (GRCm39) missense probably damaging 1.00
R2317:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2330:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2345:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2349:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2353:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2354:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2566:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2567:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2568:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2893:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2894:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2937:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2938:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2990:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2992:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2993:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3029:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3030:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3195:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R3441:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3442:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3608:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3686:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4119:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4120:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4477:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4478:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4480:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4580:Cdh15 UTSW 8 123,591,897 (GRCm39) missense probably damaging 0.99
R4583:Cdh15 UTSW 8 123,591,767 (GRCm39) missense probably damaging 0.98
R4619:Cdh15 UTSW 8 123,587,612 (GRCm39) missense probably damaging 1.00
R4694:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4731:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R5076:Cdh15 UTSW 8 123,591,087 (GRCm39) missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 123,588,802 (GRCm39) missense probably null 1.00
R5375:Cdh15 UTSW 8 123,591,839 (GRCm39) missense probably damaging 1.00
R5498:Cdh15 UTSW 8 123,591,917 (GRCm39) missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 123,583,326 (GRCm39) missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 123,591,086 (GRCm39) missense probably benign 0.01
R6570:Cdh15 UTSW 8 123,584,130 (GRCm39) missense probably damaging 1.00
R6708:Cdh15 UTSW 8 123,590,294 (GRCm39) missense probably benign 0.32
R7505:Cdh15 UTSW 8 123,575,231 (GRCm39) missense probably benign 0.01
R7527:Cdh15 UTSW 8 123,588,865 (GRCm39) missense probably damaging 1.00
R7724:Cdh15 UTSW 8 123,593,700 (GRCm39) missense probably damaging 1.00
R8093:Cdh15 UTSW 8 123,593,574 (GRCm39) missense probably damaging 1.00
R8485:Cdh15 UTSW 8 123,584,105 (GRCm39) missense probably damaging 1.00
R8759:Cdh15 UTSW 8 123,587,628 (GRCm39) missense probably damaging 1.00
R8910:Cdh15 UTSW 8 123,575,240 (GRCm39) missense probably benign 0.04
R9017:Cdh15 UTSW 8 123,584,256 (GRCm39) critical splice donor site probably null
R9453:Cdh15 UTSW 8 123,586,029 (GRCm39) missense probably damaging 0.99
R9699:Cdh15 UTSW 8 123,588,769 (GRCm39) missense probably benign 0.00
R9705:Cdh15 UTSW 8 123,591,024 (GRCm39) missense probably damaging 1.00
Z1176:Cdh15 UTSW 8 123,590,998 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTACAGTGAGCCATGCACGC -3'
(R):5'- GATGTTGTCCCGAAGGTCCTCTTG -3'

Sequencing Primer
(F):5'- TCCGACATCAGGTCTCCGAG -3'
(R):5'- TCTTGTAGGCCATGCAACAG -3'
Posted On 2014-01-05