Incidental Mutation 'R1023:Ubtf'
ID94655
Institutional Source Beutler Lab
Gene Symbol Ubtf
Ensembl Gene ENSMUSG00000020923
Gene Nameupstream binding transcription factor, RNA polymerase I
SynonymsA930005G04Rik, UBF1, Tcfubf, UBF
MMRRC Submission 039125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1023 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102304560-102319742 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102311450 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 197 (E197G)
Ref Sequence ENSEMBL: ENSMUSP00000136310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006754] [ENSMUST00000079589] [ENSMUST00000107115] [ENSMUST00000107117] [ENSMUST00000107119] [ENSMUST00000107123] [ENSMUST00000128016] [ENSMUST00000146896] [ENSMUST00000173870] [ENSMUST00000174302] [ENSMUST00000178839]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006754
AA Change: E197G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006754
Gene: ENSMUSG00000020923
AA Change: E197G

DomainStartEndE-ValueType
Blast:SANT 18 78 6e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 640 661 N/A INTRINSIC
low complexity region 677 705 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079589
AA Change: E197G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078539
Gene: ENSMUSG00000020923
AA Change: E197G

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107115
AA Change: E197G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102732
Gene: ENSMUSG00000020923
AA Change: E197G

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107117
AA Change: E197G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102734
Gene: ENSMUSG00000020923
AA Change: E197G

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107119
AA Change: E197G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102736
Gene: ENSMUSG00000020923
AA Change: E197G

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107123
AA Change: E197G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102740
Gene: ENSMUSG00000020923
AA Change: E197G

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128016
SMART Domains Protein: ENSMUSP00000131930
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 2e-34 BLAST
HMG 111 169 1.15e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146896
SMART Domains Protein: ENSMUSP00000134665
Gene: ENSMUSG00000020923

DomainStartEndE-ValueType
Blast:SANT 18 78 1e-34 BLAST
HMG 83 151 2.09e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173870
AA Change: E197G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133611
Gene: ENSMUSG00000020923
AA Change: E197G

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174302
AA Change: E197G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133844
Gene: ENSMUSG00000020923
AA Change: E197G

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 195 265 1.95e-15 SMART
HMG 297 363 1.1e-14 SMART
HMG 406 476 6.29e-19 SMART
HMG 481 550 4.74e-5 SMART
HMG 567 635 2.54e-14 SMART
low complexity region 675 763 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174726
Predicted Effect possibly damaging
Transcript: ENSMUST00000178839
AA Change: E197G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136310
Gene: ENSMUSG00000020923
AA Change: E197G

DomainStartEndE-ValueType
Blast:SANT 18 78 8e-32 BLAST
HMG 111 181 5.56e-20 SMART
HMG 260 326 1.1e-14 SMART
HMG 369 439 6.29e-19 SMART
HMG 444 513 4.74e-5 SMART
HMG 530 598 2.54e-14 SMART
low complexity region 638 726 N/A INTRINSIC
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.6%
  • 20x: 90.7%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HMG-box DNA-binding protein family. The encoded protein plays a critical role in ribosomal RNA transcription as a key component of the pre-initiation complex, mediating the recruitment of RNA polymerase I to rDNA promoter regions. The encoded protein may also play important roles in chromatin remodeling and pre-rRNA processing, and its activity is regulated by both phosphorylation and acetylation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the short arm of chromosomes 3, 11 and X and the long arm of chromosome 11. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before implantation with embryonic growth arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,066,871 A607V probably damaging Het
4930523C07Rik A G 1: 160,077,487 probably benign Het
Ap3d1 A T 10: 80,714,258 L713Q probably damaging Het
Baz2a A G 10: 128,121,807 T1010A possibly damaging Het
Cd163l1 T A 7: 140,224,463 C484S possibly damaging Het
Cdh15 T C 8: 122,865,200 I608T probably damaging Het
Cdkl2 A T 5: 92,039,286 D40E possibly damaging Het
Col9a2 G A 4: 121,044,010 G118R unknown Het
Cryge C A 1: 65,050,786 C79F probably damaging Het
Dapk1 T C 13: 60,730,985 L596P probably damaging Het
Dqx1 G A 6: 83,061,089 C486Y probably damaging Het
Enam A G 5: 88,501,967 Q445R probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gnpat A T 8: 124,870,780 D27V probably benign Het
Htr5a A T 5: 27,842,998 T184S possibly damaging Het
Lap3 C T 5: 45,495,211 P50S probably benign Het
Mamdc2 A T 19: 23,310,907 M589K probably damaging Het
Mast4 A G 13: 102,735,496 S2263P probably benign Het
Mef2b C T 8: 70,165,597 P109L possibly damaging Het
Meltf T A 16: 31,884,960 F168L probably damaging Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nup205 T A 6: 35,234,706 F1661I probably damaging Het
Olfr187 A T 16: 59,035,815 N307K probably benign Het
Olfr747 A T 14: 50,681,016 L206H probably damaging Het
Plac8 A T 5: 100,556,581 D83E probably benign Het
Pnpt1 T C 11: 29,141,328 probably benign Het
Pold2 G T 11: 5,875,140 Q86K probably benign Het
Ptprt A G 2: 161,558,943 L1057P probably damaging Het
Rev3l A G 10: 39,832,639 H2284R probably damaging Het
Skint6 A C 4: 113,238,103 S120A probably benign Het
Slc1a7 G A 4: 108,007,573 V270M probably damaging Het
Spata2 A G 2: 167,485,222 M85T probably benign Het
Taf1b G T 12: 24,509,559 probably benign Het
Tert A G 13: 73,642,059 N844S probably benign Het
Thrap3 G A 4: 126,180,089 S288L possibly damaging Het
Ubap2l A G 3: 90,047,873 probably benign Het
Usp20 G T 2: 31,007,813 G216W probably damaging Het
Wdr60 T C 12: 116,232,657 E490G probably damaging Het
Yy1 T A 12: 108,793,531 V40E unknown Het
Zfp335 G A 2: 164,892,585 H1254Y possibly damaging Het
Other mutations in Ubtf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Ubtf APN 11 102308884 splice site probably benign
IGL02168:Ubtf APN 11 102314168 missense probably damaging 0.99
IGL02218:Ubtf APN 11 102306700 nonsense probably null
FR4304:Ubtf UTSW 11 102306956 small insertion probably benign
FR4304:Ubtf UTSW 11 102306958 small insertion probably benign
FR4340:Ubtf UTSW 11 102306950 small insertion probably benign
FR4342:Ubtf UTSW 11 102306956 small insertion probably benign
FR4342:Ubtf UTSW 11 102306959 small insertion probably benign
FR4449:Ubtf UTSW 11 102306948 nonsense probably null
FR4548:Ubtf UTSW 11 102306958 small insertion probably benign
FR4589:Ubtf UTSW 11 102306943 small insertion probably benign
FR4589:Ubtf UTSW 11 102306945 small insertion probably benign
FR4737:Ubtf UTSW 11 102306948 nonsense probably null
FR4737:Ubtf UTSW 11 102306950 small insertion probably benign
FR4976:Ubtf UTSW 11 102306959 small insertion probably benign
PIT4504001:Ubtf UTSW 11 102306682 missense unknown
R0919:Ubtf UTSW 11 102309777 splice site probably benign
R1641:Ubtf UTSW 11 102310931 missense probably damaging 1.00
R1678:Ubtf UTSW 11 102308978 missense probably benign 0.01
R1780:Ubtf UTSW 11 102314918 missense probably damaging 1.00
R2406:Ubtf UTSW 11 102308702 nonsense probably null
R4574:Ubtf UTSW 11 102306765 unclassified probably benign
R4986:Ubtf UTSW 11 102314174 missense probably benign 0.03
R5057:Ubtf UTSW 11 102307087 missense probably damaging 0.96
R5217:Ubtf UTSW 11 102308302 missense probably null 0.91
R5221:Ubtf UTSW 11 102307990 nonsense probably null
R5532:Ubtf UTSW 11 102308959 missense probably benign 0.00
R5634:Ubtf UTSW 11 102310324 missense probably damaging 1.00
R6185:Ubtf UTSW 11 102314023 missense probably damaging 1.00
R7028:Ubtf UTSW 11 102314980 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTAGTGGCCTGCAAACCAAAAGC -3'
(R):5'- TGACCGTCCATGAAACGTGGAAG -3'

Sequencing Primer
(F):5'- AGGCCCTGTCCATGCAATC -3'
(R):5'- TCCATGAAACGTGGAAGTCTTG -3'
Posted On2014-01-05